Aedes simpsoni

(Theobald, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records141

Data sources6

Biological traits0

DNA specimens26

eDNA detections12

Sources6 archives

Databases and archives Aedes simpsoni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingBOLD26 specimens

01Narrative

Stegomyia simpsoni is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1905 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes simpsoni has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes3

eDNA detections12

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P594 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

3Amostly conserved

14Gmostly conserved

34Cmostly conserved

42Cvariable

48Amostly conserved

60Amostly conserved

120Amostly conserved

160Gmostly conserved

168Amostly conserved

231Tvariable

252Tmostly conserved

255Tmostly conserved

258Cmostly conserved

300Cmostly conserved

303Tmostly conserved

324Cvariable

333Amostly conserved

334Gmostly conserved

339Amostly conserved

367Tmostly conserved

381Amostly conserved

393Amostly conserved

423Tmostly conserved

468Amostly conserved

471Amostly conserved

474Tmostly conserved

496Tmostly conserved

525Amostly conserved

537Amostly conserved

543Amostly conserved

567Tmostly conserved

576Cmostly conserved

588Amostly conserved

594Cmostly conserved

GGAACTTCTTTAAGAATTTTAATTCGAACAGAACTAAGTCACCCTGGAATATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes6

BIN1

Most divergent pair3.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes luteocephalussame genus7.7%Aedes mcintoshisame genus8.2%Aedes vittatussame genus8.4%Aedes contiguussame genus8.4%Aedes vexanssame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type141 records

Wild obs. + sensor23

Museum / vouchered118

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 2≤1 km 3≤10 km 1>10 km 3

9 georeferenced · 14 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 35

35 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	32
Washington, US	18
Cambridge, US	3
Cape Town, ZA	1
University of Queensland Insect Collectionlocation not on record	1

5 institutions · 55 of 118 vouchered records shown · 63 without an institution code

09Environmental DNA12 detections

Where the DNA of Aedes simpsoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)