Aedes rossicus

Dolbeškin, Goritskaya & Mitrofanova · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records53

Data sources5

Biological traits0

DNA specimens9

eDNA detections2

Sources5 archives

Databases and archives Aedes rossicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aedes rossicus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1930 door Dolbeskin, Gorickaja & Mitrofanova.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes rossicus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P580 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 87 variable positions, in barcode order

10Amostly conserved

13Cmostly conserved

14Gmostly conserved

15Tmostly conserved

17Cmostly conserved

18Amostly conserved

19Gmostly conserved

20Amostly conserved

21Amostly conserved

25Amostly conserved

26Gmostly conserved

30Tmostly conserved

34Amostly conserved

75Amostly conserved

87Amostly conserved

111Tmostly conserved

132Amostly conserved

138Tmostly conserved

145Cmostly conserved

147Tmostly conserved

160Tmostly conserved

183Tmostly conserved

186Tmostly conserved

207Tmostly conserved

219Tmostly conserved

226Tmostly conserved

228Amostly conserved

231Cmostly conserved

234Gmostly conserved

235Tmostly conserved

238Tmostly conserved

240Amostly conserved

243Amostly conserved

246Cmostly conserved

247Tmostly conserved

248Cmostly conserved

249Amostly conserved

264Amostly conserved

265Gmostly conserved

270Tmostly conserved

276Gmostly conserved

279Amostly conserved

282Tmostly conserved

288Cmostly conserved

291Tmostly conserved

295Tmostly conserved

297Amostly conserved

300Tmostly conserved

303Tmostly conserved

318Amostly conserved

323Gmostly conserved

333Cmostly conserved

337Gmostly conserved

345Cmostly conserved

349Tmostly conserved

351Amostly conserved

360Cmostly conserved

363Gmostly conserved

364Amostly conserved

369Tmostly conserved

372Gmostly conserved

381Gmostly conserved

384Cmostly conserved

402Tmostly conserved

405Tvariable

414Amostly conserved

426Amostly conserved

432Amostly conserved

433Cmostly conserved

435Tmostly conserved

442Cmostly conserved

444Tmostly conserved

462Amostly conserved

465Tmostly conserved

468Tmostly conserved

474Tmostly conserved

490Cmostly conserved

492Tmostly conserved

499Cmostly conserved

504Tmostly conserved

513Gmostly conserved

534Tmostly conserved

552Amostly conserved

555Amostly conserved

561Tmostly conserved

567Tvariable

580Avariable

AGTATATTAATTCGTGCAGAATTAAGTCATCCAAGTATATTTATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGCATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes4

BINs2

Most divergent pair2.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes yamadaisame genus2.5%Aedes cinereussame genus4.1%Aedes esoensissame genus5.5%Aedes mcintoshisame genus9.1%Aedes bekkuisame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor26

Museum / vouchered27

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 16≤1 km 1≤10 km 3

20 georeferenced · 6 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rovaniemi, FI	16
NPlocation not on record	1

2 institutions · 17 of 27 vouchered records shown · 10 without an institution code

09Environmental DNA2 detections

Where the DNA of Aedes rossicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)