Aedes esoensis

Yamada, 1921 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1

Data sources5

Biological traits0

DNA specimens14

eDNA detections14

Sources5 archives

Databases and archives Aedes esoensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Aedes esoensis is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1921 door Yamada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes esoensis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

26Tvariable

35Amostly conserved

44Cmostly conserved

53Avariable

77Cvariable

101Cmostly conserved

104Amostly conserved

176Amostly conserved

179Amostly conserved

182Cvariable

212Avariable

227Tmostly conserved

230Tvariable

257Amostly conserved

266Cmostly conserved

284Gvariable

311Amostly conserved

323Gvariable

335Tmostly conserved

338Tmostly conserved

350Tvariable

368Amostly conserved

377Tmostly conserved

428Gmostly conserved

467Gmostly conserved

470Avariable

506Amostly conserved

548Tmostly conserved

557Cvariable

560Amostly conserved

572Amostly conserved

573Cvariable

584Tmostly conserved

590Cmostly conserved

611Cmostly conserved

614Amostly conserved

620Avariable

623Avariable

629Cvariable

641Tmostly conserved

TATATTTTATTTTTGGAGTTTGATCTGGAATAGTAGGAACATCCTTAAGTATATTAATTCGTGCAGAGTTAAGTCACCCTAGTATATTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes13

BIN1

Most divergent pair3.2%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes rossicussame genus5.5%Aedes yamadaisame genus6.0%Aedes cinereussame genus6.0%Aedes bekkuisame genus9.1%Aedes dentatussame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

09Environmental DNA14 detections

Where the DNA of Aedes esoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C 7.50–10.4

Seasonal swing summer↔winter25.0 °C

Max temp (day)12.2 °C 9.60–12.6

Min temp (night)5.90 °C 3.10–7.00

Precipitation147 mm/mo 127–239

Air humidity62.0 % 61.0–64.8

Moisture balance66.0 mm/mo 47.3–162

Vapour deficit535 Pa 434–536

Wind speed3.20 m/s 2.70–3.90

Cloud cover47.3 % 46.4–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)