Aedes riversi

Bohart & Ingram, 1946 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records3

Data sources5

Biological traits0

DNA specimens21

eDNA detections21

Sources5 archives

Databases and archives Aedes riversi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Stegomyia riversi is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1946 door Bohart & Ingram.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes riversi has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes2

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

35Tmostly conserved

83Gvariable

101Cvariable

122Tmostly conserved

260Amostly conserved

311Avariable

326Gvariable

359Tvariable

428Amostly conserved

479Amostly conserved

503Tvariable

611Tmostly conserved

629Cmostly conserved

TATATTTTATTTTTGGAGTATGATCTGGAATAGTTGGAACTTCATTAAGAGTTTTAATTCGAACTGAACTTAGTCATCCTGGGATATTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes15

BINs2

Most divergent pair2.3%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes malayensissame genus3.7%Aedes scutellarissame genus3.9%Aedes pseudoscutellarissame genus5.2%Aedes polynesiensissame genus5.2%Aedes katherinensissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type3 records

Wild obs. + sensor1

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA21 detections

Where the DNA of Aedes riversi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 7.40–16.6

Seasonal swing summer↔winter19.6 °C

Max temp (day)17.0 °C 9.60–18.1

Min temp (night)14.4 °C 3.00–14.6

Precipitation228 mm/mo 146–344

Air humidity60.4 % 59.5–64.9

Moisture balance263 mm/mo

Vapour deficit737 Pa 428–767

Wind speed2.90 m/s

Cloud cover36.8 % 36.2–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)