Aedes polynesiensis

Marks, 1954 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records65

Data sources9

Biological traits0

DNA specimens30

eDNA detections5

Sources9 archives

Databases and archives Aedes polynesiensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT · NCBI714 Mbp

01Narrative

Aedes polynesiensis (also known as the Polynesian tiger mosquito) is only found in the South Pacific on the islands of Austral Islands, Cook Islands, Ellice Islands, Fiji Islands, Hoorn Islands, Marquesas Islands, Pitcairn Island, Samoa Islands, Society Islands, Tokelau Islands, Tuamotu Archipelago. It is a vector of dengue, Ross River virus,Rosen, Leon, Duane J. Gubler and Peter H. Bennett. 1981. "Epidemic polyarthritis (Ross River) virus infection in the Cook Islands" Am. J. Trop. Med. Hyg. 30(6): 1294-1302 and lymphatic filariasis, and a probable vector of Zika virus.European Centre for Disease Prevention and Control. 2014. Rapid risk assessment: Zika virus infection outbreak, French Polynesia. Stockholm: ECDC, http://ecdc.europa.eu/en/publications/Publications/Zika-virus-French-Polynesia-rapid-risk-assessment.pdf , 14 February 2014. Adults lay eggs in natural and human-associated pools of freshwater. Common larval habitats include tree holes, holes in volcanic rock formations, coconut shells, water storage containers (drums), and discarded trash (including tires and bottles).Samarawickrema, W.A., Fola Sone, E. Kimura, L.S. Self, R.F. Cummings and G.S. Paulson. 1993. "The relative importance and distribution of Aedes polynesiensis and Ae. aegypti larval habitats in Samoa. Med. and Vet. Entom. 7: 27-36"Bonnet, David B. and Herald Chapman. 1958. "The larval habitats of Aedes polynesiensis Marks in Tahiti and methods of control." Am. J. Trop. Med. Hyg. 7(5): 512-518

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes polynesiensis has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes2

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

348Amostly conserved

393Tmostly conserved

441Avariable

552Gmostly conserved

TGATCTGGAATAGTAGGAACTTCTTTAAGAGTTTTAATTCGAACTGAACTTAGTCACCCTGGTATATTTATTGGAAATGACCAAATTTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes8

BIN1

Most divergent pair0.49%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes futunaesame genus4.9%Aedes riversisame genus5.2%Aedes katherinensissame genus5.8%Aedes scutellarissame genus6.1%Aedes malayensissame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aedes polynesiensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size713 940 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes polynesiensis0.71 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 62×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type65 records

Wild obs. + sensor6

Museum / vouchered59

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 3>10 km 3

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 59 records without

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	59

1 institutions · 59 of 59 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Aedes polynesiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)