Aedes nigromaculis

(Ludlow, 1906) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records5 842

Data sources5

Biological traits0

DNA specimens245

eDNA detections11

Sources5 archives

Databases and archives Aedes nigromaculis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 842 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics245 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 842 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD245 specimens

01Narrative

Ochlerotatus nigromaculis is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1906 door Ludlow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding245 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes nigromaculis has left across the world's sequence archives.

At a glance

DNA specimens245

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus191 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

34Tmostly conserved

58Cmostly conserved

115Cmostly conserved

322Tmostly conserved

328Amostly conserved

340Cmostly conserved

385Cmostly conserved

416Gmostly conserved

562Tmostly conserved

574Amostly conserved

634Tmostly conserved

TACATTATATTTTATTTTCGGAGTTTGATCAGGTATAGTTGGTACATCATTAAGAATCTTAATTCGTGCTGAACTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 61 variants.

Diversity (π)1.4%

Haplotypes61

BIN1

Most divergent pair13.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes taeniorhynchussame genus2.0%Aedes mitchellaesame genus2.3%Aedes caspiussame genus5.8%Aedes dorsalissame genus6.1%Aedes mariaesame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 842 records

Wild obs. + sensor4 812

Museum / vouchered1 030

Range

Area of Occupancy AOO1 884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 5≤1 km 6>10 km 2

13 georeferenced · 4 799 without coordinates

Open the mapobservation + sensor4 812

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 795≤1 km 3≤10 km 71>10 km 43

912 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence1 030

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	792
San Francisco, US	70
National Ecological Observatory Network, United Stateslocation not on record	49
Champaign, US	36
Wuzhou, CN	35
Denton, US	15
UNHClocation not on record	15
NEON Biorepository at Arizona State Universitylocation not on record	9
WIlocation not on record	3
Denver, US	3
Albuquerque, US	1
Cambridge, US	1
CUlocation not on record	1

13 institutions · 1 030 of 1 030 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Aedes nigromaculis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

cultivatedCropsgrasslandHerbaceous

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 19.1–26.7

Seasonal swing summer↔winter27.8 °C

Max temp (day)28.8 °C 25.8–32.4

Min temp (night)18.5 °C 13.7–22.1

Precipitation121 mm/mo 98.2–150

Air humidity56.5 % 55.3–58.1

Moisture balance-58.0 mm/mo -102–-11.6

Vapour deficit1,204 Pa 1,021–1,541

Wind speed4.40 m/s 3.90–4.60

Cloud cover30.1 % 24.9–34.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes nigromaculis

At a glance

Sources5 archives

At a glance

Record type5 842 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 842 records