Aedes geniculatus

(Olivier, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records2 583

Data sources7

Biological traits2

DNA specimens116

eDNA detections113

Sources7 archives

Databases and archives Aedes geniculatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 583 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI113 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics116 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 583 records

Environmental DNA3 datasets · 12 countries113 detections

DNA & barcodingBOLD116 specimens

01Narrative

Aedes geniculatus, also known as the tree hole mosquito, is closely related to the better known Asian tiger mosquito and is native to Europe and North Africa. After the Zika epidemic in 2016, it was mistakenly reported to Public Health England by members of the public, who were monitoring the spread of Zika-carrying mosquitoes in southern England following media reports of the spread of the Asian tiger mosquito. Although it has not been observed in the wild as a disease vector, in laboratory tests, the tree hole mosquito can transmit yellow fever and chikungunya and so may be able to spread the Zika virus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding116 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes geniculatus has left across the world's sequence archives.

At a glance

DNA specimens116

BINs4

Marker genes6

eDNA detections113

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus103 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

22Gmostly conserved

31Amostly conserved

49Cmostly conserved

67Cvariable

85Amostly conserved

88Amostly conserved

103Tmostly conserved

112Tmostly conserved

166Amostly conserved

184Amostly conserved

187Cvariable

202Amostly conserved

217Amostly conserved

220Tmostly conserved

229Gmostly conserved

271Cvariable

274Gmostly conserved

284Cmostly conserved

286Tmostly conserved

307Amostly conserved

316Avariable

319Tmostly conserved

334Amostly conserved

337Avariable

340Cvariable

343Cmostly conserved

361Tmostly conserved

364Cmostly conserved

406Tmostly conserved

407Tmostly conserved

415Amostly conserved

418Tmostly conserved

433Gmostly conserved

454Tmostly conserved

457Amostly conserved

475Amostly conserved

490Cmostly conserved

494Tmostly conserved

508Tmostly conserved

533Cmostly conserved

535Gvariable

556Gvariable

562Cvariable

586Tmostly conserved

616Cmostly conserved

619Tmostly conserved

646Tmostly conserved

TACATTATATTTCATTTTTGGGGTATGATCAGGAATAGTAGGAACATCCTTAAGAATTTTAATTCGCGCTGAATTAAGAACTCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes33

BINs4

Most divergent pair6.8%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes perventorsame genus8.7%Aedes dorsalissame genus9.4%Aedes rubrithoraxsame genus9.4%Aedes atlanticussame genus9.6%Aedes vargasisame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS1★ITS216S18S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type2 583 records

Wild obs. + sensor2 457

Museum / vouchered126

Origin

Native64

Range

Area of Occupancy AOO3 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 1 040≤1 km 71≤10 km 324>10 km 11

1 446 georeferenced · 1 011 without coordinates

Open the mapobservation + sensor2 457

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤1 km 23≤10 km 16>10 km 10

49 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ITGlocation not on record	26
New Haven, US	20
South Kensington, GB	17
NCMGlocation not on record	12
University of Queensland Insect Collectionlocation not on record	2
PPlocation not on record	1
Animal and Plant Health Agency, UKlocation not on record	1
University of Primorskalocation not on record	1
BMNHlocation not on record	1
Champaign, US	1

10 institutions · 82 of 126 vouchered records shown · 42 without an institution code

09Environmental DNA113 detections

Where the DNA of Aedes geniculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found113

Studies independent surveys3

Countries12

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 113 detections have coordinates

Open the map12 countries0

Mediterranean forestCattle farm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.3 °C 7.60–21.5

Seasonal swing summer↔winter16.6 °C

Max temp (day)17.9 °C 10.7–25.2

Min temp (night)9.50 °C 4.00–18.2

Precipitation68.7 mm/mo 49.8–98.3

Air humidity61.5 % 56.1–66.2

Moisture balance-3.10 mm/mo -84.3–26.5

Vapour deficit670 Pa 403–1,118

Wind speed3.10 m/s 2.30–4.30

Cloud cover41.5 % 35.4–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes geniculatus

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 583 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 583 records