Aedes bromeliae

(Theobald, 1911) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records35

Data sources5

Biological traits0

DNA specimens71

eDNA detections48

Sources5 archives

Databases and archives Aedes bromeliae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 2 countries48 detections

DNA & barcodingBOLD71 specimens

01Narrative

Stegomyia bromeliae is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1911 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes bromeliae has left across the world's sequence archives.

At a glance

DNA specimens71

BINs1

Marker genes5

eDNA detections48

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P467 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

78Gmostly conserved

86Avariable

149Tvariable

163Tmostly conserved

218Cvariable

221Tvariable

242Tvariable

251Avariable

285Tvariable

299Amostly conserved

311Amostly conserved

389Gvariable

395Tmostly conserved

413Amostly conserved

443Avariable

TTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes10

BIN1

Most divergent pair2.6%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes vittatussame genus7.7%Aedes mcintoshisame genus7.9%Aedes luteocephalussame genus7.9%Aedes cogillisame genus7.9%Aedes vexanssame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1★ITS218S-5PCYTB

animal barcodefungal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type35 records

Wild obs. + sensor1

Museum / vouchered34

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MMaplocation not on record	1

1 institutions · 1 of 34 vouchered records shown

09Environmental DNA48 detections

Where the DNA of Aedes bromeliae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.4–22.8

Seasonal swing summer↔winter4.70 °C

Max temp (day)27.1 °C

Min temp (night)18.5 °C 18.2–18.5

Precipitation146 mm/mo 102–146

Air humidity60.4 % 60.4–63.7

Moisture balance-12.1 mm/mo -31.2–-12.1

Vapour deficit1,104 Pa 982–1,104

Wind speed1.70 m/s 1.10–1.70

Cloud cover29.5 % 29.5–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)