Aedes abserratus

(Felt & Young, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records586

Data sources6

Biological traits0

DNA specimens136

eDNA detections1

Sources6 archives

Databases and archives Aedes abserratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility586 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics136 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF586 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD136 specimens

01Narrative

Ochlerotatus abserratus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Felt & Young.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding136 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes abserratus has left across the world's sequence archives.

At a glance

DNA specimens136

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus136 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

148Gmostly conserved

166Gmostly conserved

181Gmostly conserved

220Gmostly conserved

364Cmostly conserved

412Gmostly conserved

466Gmostly conserved

493Amostly conserved

646Cmostly conserved

GACATTATATTTTATTTTCGGAGTTTGATCTGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGACAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes22

BINs2

Most divergent pair5.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes aboriginissame genus2.6%Aedes ventrovittissame genus4.7%Aedes communissame genus4.9%Aedes churchillensissame genus6.1%Aedes tahoensissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type586 records

Wild obs. + sensor189

Museum / vouchered397

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 13

13 georeferenced · 176 without coordinates

Open the mapobservation + sensor189

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 49≤1 km 6≤10 km 92>10 km 12

159 georeferenced · 238 without coordinates

Open the institutions mapphysical evidence397

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint John, CA	105
New Haven, US	104
University of Guelph, Centre for Biodiversity Genomicslocation not on record	61
UNHClocation not on record	36
Tempe, US	32
Wuzhou, CN	30
Edmonton, CA	13
Mosquitolocation not on record	5
Cambridge, US	3
San Francisco, US	3
University of Guelphlocation not on record	1
National Ecological Observatory Network, United Stateslocation not on record	1
Bronx, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Champaign, US	1

15 institutions · 397 of 397 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aedes abserratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

mixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 17.1–17.1

Seasonal swing summer↔winter29.3 °C

Max temp (day)22.0 °C

Min temp (night)12.1 °C

Precipitation121 mm/mo

Air humidity59.6 %

Moisture balance-9.70 mm/mo

Vapour deficit783 Pa

Wind speed1.80 m/s

Cloud cover42.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)