Adontosternarchus sachsi

(Peters, 1877) · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Adontosternarchus

At a glance

Occurrence records260

Data sources7

Biological traits4

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Adontosternarchus sachsi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF260 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Adontosternarchus sachsi is een straalvinnige vissensoort uit de familie van de staartvinmesalen (Apteronotidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1877 door Peters.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length32.2 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability22.2

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adontosternarchus sachsi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P665 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BIN1

Most divergent pair1.8%

Where individuals differ — all 21 variable positions, in barcode order

3Cmostly conserved

6Avariable

97Tvariable

177Avariable

198Gvariable

216Tvariable

222Avariable

264Gvariable

333Gvariable

388Cmostly conserved

459Cvariable

471Amostly conserved

513Gvariable

516Gvariable

519Gvariable

546Cvariable

555Tvariable

558Tvariable

579Gvariable

621Avariable

624Avariable

GGCACACTATACATAGTGTTTGGCGCCTGGGCCGGTATAATTGGTACCGCCCTCAGCCTATTGATTCGAGCAGAGCTCAACCAACCGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adontosternarchus devenanziisame genus8.2%Adontosternarchus clarkaesame genus8.2%Adontosternarchus nebulosussame genus8.7%Adontosternarchus balaenopssame genus9.6%Sternarchorhynchus rosenisame family12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type260 records

Wild obs. + sensor3

Museum / vouchered257

Origin

Native23

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 7≤10 km 4>10 km 4

16 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	54
PUC-RSlocation not on record	34
Museu de Zoologia da Universidade de Sao Paulolocation not on record	29
Washington, US	29
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	25
Los Angeles, US	23
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	19
Universidad del Tolima (UT)location not on record	8
Cambridge, US	5
Ann Arbor, US	5
FishBaselocation not on record	4
Montgomery, US	4
CASlocation not on record	4
South African Institute for Aquatic Biodiversitylocation not on record	4
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
South Kensington, GB	2
Toronto, CA	1
Universidad de Antioquia (UdeA)location not on record	1

19 institutions · 256 of 257 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Adontosternarchus sachsi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)