Adontosternarchus balaenops

(Cope, 1878) · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Adontosternarchus

At a glance

Occurrence records204

Data sources7

Biological traits4

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Adontosternarchus balaenops's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF204 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Adontosternarchus balaenops is een straalvinnige vissensoort uit de familie van de staartvinmesalen (Apteronotidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1878 door Cope.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability15

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adontosternarchus balaenops has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

18Gvariable

27Avariable

105Cmostly conserved

186Avariable

252Avariable

321Avariable

480Cmostly conserved

501Avariable

ATAGTATTTGGCGCCTGGGCCGGTATAATTGGAACTGCTCTCAGCCTATTAATTCGAGCTGAGCTCAACCAACCCGGCACCCTCTTAGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes3

BIN1

Most divergent pair0.93%

OtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adontosternarchus nebulosussame genus7.6%Adontosternarchus devenanziisame genus8.4%Adontosternarchus sachsisame genus9.6%Adontosternarchus clarkaesame genus10.0%Sternarchorhynchus mormyrussame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type204 records

Wild obs. + sensor4

Museum / vouchered200

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
PUC-RSlocation not on record	45
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	41
Chicago, US	33
Museu de Zoologia da Universidade de Sao Paulolocation not on record	24
University of Nebraskalocation not on record	15
Washington, US	11
CIRA-UNANlocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Champaign, US	5
Montgomery, US	3
Toronto, CA	3
UNICAMPlocation not on record	3
Museo de Historia Natural “Gustavo Orcés V"location not on record	2
CASlocation not on record	1
USP-RPlocation not on record	1
Ann Arbor, US	1
South Kensington, GB	1

17 institutions · 199 of 200 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Adontosternarchus balaenops was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.6–25.6

Seasonal swing summer↔winter1.30 °C

Max temp (day)28.9 °C

Min temp (night)23.2 °C

Precipitation280 mm/mo

Air humidity72.1 %

Moisture balance151 mm/mo

Vapour deficit919 Pa

Wind speed0.8 m/s

Cloud cover55.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)