Adoneta spinuloides

(Herrich-Schäffer, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Adoneta

At a glance

Occurrence records1 507

Data sources7

Biological traits0

DNA specimens17

eDNA detections16

Sources7 archives

Databases and archives Adoneta spinuloides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 507 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 507 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

Adoneta spinuloides, the purple-crested slug moth, is a species of slug caterpillar moth in the family Limacodidae. The MONA or Hodges number for Adoneta spinuloides is 4685. Purple-crested slug moth, Adoneta spinuloides

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoneta spinuloides has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

34Gmostly conserved

46Amostly conserved

97Tmostly conserved

100Cmostly conserved

172Tmostly conserved

202Cmostly conserved

268Cmostly conserved

271Cmostly conserved

301Cmostly conserved

403Gmostly conserved

412Tmostly conserved

421Cmostly conserved

433Gvariable

466Gmostly conserved

472Tmostly conserved

487Tmostly conserved

514Tmostly conserved

536Tmostly conserved

557Tmostly conserved

565Amostly conserved

574Tmostly conserved

604Gmostly conserved

610Cmostly conserved

628Amostly conserved

634Cmostly conserved

641Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGGATAGTCGGAACATCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes10

BINs3

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phocoderma velutinasame family7.3%Euclea busckisame family7.3%Adoneta bicaudatasame genus7.4%Adoneta geminasame genus7.6%Euclea gajentaanisame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 507 records

Wild obs. + sensor1 256

Museum / vouchered251

Range

Area of Occupancy AOO3 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 552≤1 km 212≤10 km 98>10 km 158

1 020 georeferenced · 236 without coordinates

Open the mapobservation + sensor1 256

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 3≤1 km 9≤10 km 72>10 km 20

104 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	87
New Haven, US	43
CUlocation not on record	21
Washington, US	21
East Lansing, US	19
Cleveland Museum of Natural History, OH (CLEV)location not on record	14
Cambridge, US	12
Georgia Museum of Natural Historylocation not on record	7
Philadelphia, US	6
St. Paul, US	5
University of Alberta Museums (UAM)location not on record	4
Denver, US	2
Cornell University Insect Collectionlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Natural History Museum of Utahlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

16 institutions · 246 of 251 vouchered records shown · 5 without an institution code

09Environmental DNA16 detections

Where the DNA of Adoneta spinuloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

Calcareous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 4.00–25.3

Seasonal swing summer↔winter20.5 °C

Max temp (day)22.7 °C 8.80–30.2

Min temp (night)13.7 °C 0.1–20.5

Precipitation133 mm/mo 111–155

Air humidity58.4 % 56.1–63.8

Moisture balance17.0 mm/mo -59.4–103

Vapour deficit747 Pa 338–1,380

Wind speed2.70 m/s 1.80–3.60

Cloud cover36.0 % 27.9–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adoneta spinuloides

At a glance

Sources7 archives

At a glance

Record type1 507 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 507 records