Adoneta bicaudata

Dyar, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Adoneta

At a glance

Occurrence records240

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Adoneta bicaudata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF240 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Adoneta bicaudata, the long-horned slug moth, is a species of slug caterpillar moth in the family Limacodidae. The MONA or Hodges number for Adoneta bicaudata is 4684.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoneta bicaudata has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

82Tvariable

97Cvariable

109Avariable

211Amostly conserved

214Gvariable

250Cvariable

286Cvariable

287Cmostly conserved

295Avariable

340Cvariable

401Tvariable

469Tmostly conserved

556Tvariable

610Tvariable

AACATTATATTTTATTTTTGGAATTTGATCCGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes5

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoneta geminasame genus7.3%Adoneta spinuloidessame genus7.4%Comana miltochytasame family8.7%Phocoderma velutinasame family8.8%Comana cosmocallasame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor220

Museum / vouchered20

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 97≤1 km 46≤10 km 13>10 km 17

173 georeferenced · 47 without coordinates

Open the mapobservation + sensor220

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
New Haven, US	2

2 institutions · 18 of 20 vouchered records shown · 2 without an institution code

09Environmental DNA14 detections

Where the DNA of Adoneta bicaudata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

Cypress and Juncus marsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 18.6–25.9

Seasonal swing summer↔winter24.3 °C

Max temp (day)29.0 °C 23.3–30.9

Min temp (night)18.7 °C 14.1–20.9

Precipitation102 mm/mo 82.0–156

Air humidity59.2 % 56.9–63.3

Moisture balance-56.6 mm/mo -71.7–12.6

Vapour deficit1,194 Pa 789–1,437

Wind speed2.20 m/s 1.70–2.50

Cloud cover31.1 % 28.0–33.1

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)