Admetovis similaris

Barnes, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Admetovis

At a glance

Occurrence records240

Data sources7

Biological traits0

DNA specimens25

eDNA detections25

Sources7 archives

Databases and archives Admetovis similaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF240 records

Environmental DNA1 datasets · 3 countries25 detections

DNA & barcodingBOLD25 specimens

01Narrative

Admetovis similaris is a species of cutworm or dart moth in the family Noctuidae first described by William Barnes in 1904. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Admetovis similaris has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections25

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

22Gmostly conserved

202Cmostly conserved

274Cmostly conserved

364Cmostly conserved

565Amostly conserved

AACATTATATTTTATTTTTGGGATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTTATTCGAGCTGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes5

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Admetovis oxymorussame genus3.8%Anarta deserticolasame family5.0%Anarta edwardsiisame family5.0%Scotogramma ptilodontasame family5.2%Hyssia cavernosasame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor111

Museum / vouchered129

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 56≤1 km 20≤10 km 7>10 km 8

91 georeferenced · 20 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 11≤1 km 10≤10 km 25>10 km 11

57 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	24
University of Alberta Museums (UAM)location not on record	23
Vernal, US	14
New Haven, US	14
St. Paul, US	13
ASUlocation not on record	13
Oregon State Arthropod Collectionlocation not on record	10
US	4
San Francisco, US	2
Helsinki, FI	2
WWUlocation not on record	2
Denver, US	1
East Lansing, US	1
Washington, US	1

14 institutions · 124 of 129 vouchered records shown · 5 without an institution code

09Environmental DNA25 detections

Where the DNA of Admetovis similaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.9–21.4

Seasonal swing summer↔winter15.8 °C

Max temp (day)24.7 °C 19.4–29.9

Min temp (night)10.5 °C 5.50–14.2

Precipitation7.90 mm/mo 2.70–28.7

Air humidity49.4 % 44.9–52.8

Moisture balance-149 mm/mo -163–-97.3

Vapour deficit1,000 Pa 726–1,400

Wind speed1.90 m/s 1.50–3.40

Cloud cover22.8 % 14.9–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)