Admetovis oxymorus

Grote, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Admetovis

At a glance

Occurrence records119

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Admetovis oxymorus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF119 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Admetovis oxymorus is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Admetovis oxymorus is 10269.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Admetovis oxymorus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

172Tmostly conserved

368Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTTATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type119 records

Wild obs. + sensor27

Museum / vouchered92

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 6≤1 km 8≤10 km 9>10 km 1

24 georeferenced · 3 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 3≤1 km 11≤10 km 26>10 km 2

42 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	29
University of Alberta Museums (UAM)location not on record	22
Cornell University Insect Collectionlocation not on record	9
Vernal, US	6
Oregon State Arthropod Collectionlocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Mississippi State, US	3
Denver, US	2
San Francisco, US	1
Helsinki, FI	1
Colorado State Universitylocation not on record	1
ASUlocation not on record	1
Chicago, US	1
WWUlocation not on record	1

14 institutions · 88 of 92 vouchered records shown · 4 without an institution code

09Environmental DNA14 detections

Where the DNA of Admetovis oxymorus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 13.7–18.5

Seasonal swing summer↔winter23.1 °C

Max temp (day)22.2 °C 21.2–25.1

Min temp (night)9.10 °C 6.20–11.4

Precipitation28.6 mm/mo 23.0–52.6

Air humidity49.0 % 43.8–53.2

Moisture balance-140 mm/mo -143–-72.8

Vapour deficit885 Pa 874–1,090

Wind speed2.60 m/s 1.50–2.60

Cloud cover32.1 % 12.2–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)