Adeloneivaia isara

Dognin, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Adeloneivaia

At a glance

Occurrence records890

Data sources6

Biological traits0

DNA specimens193

eDNA detections177

Sources6 archives

Databases and archives Adeloneivaia isara's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility890 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI177 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics193 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF890 records

Environmental DNA1 datasets · 3 countries177 detections

DNA & barcodingBOLD193 specimens

01Narrative

Adeloneivaia isara is een vlinder uit de familie van de nachtpauwogen (Saturniidae), onderfamilie Ceratocampinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd door Paul Dognin in 1905.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding193 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adeloneivaia isara has left across the world's sequence archives.

At a glance

DNA specimens193

BINs2

Marker genes1

eDNA detections177

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus173 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

37Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Tmostly conserved

48Cmostly conserved

50Tmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

58Amostly conserved

59Cmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

80Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Cmostly conserved

86Amostly conserved

87Gmostly conserved

88Amostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

103Tmostly conserved

202Tmostly conserved

217Gmostly conserved

313Tmostly conserved

352Cmostly conserved

361Cmostly conserved

415Gmostly conserved

463Cmostly conserved

556Cmostly conserved

574Cmostly conserved

622Cmostly conserved

646Tmostly conserved

AACACTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTACTTATTCGAGCTGAATTAGGTACCCCCAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes16

BINs2

Most divergent pair9.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adeloneivaia mexicensissame genus7.8%Adeloneivaia subangulatasame genus8.4%Adeloneivaia wellingisame genus8.5%Adeloneivaia irroratasame genus8.5%Adeloneivaia pallidasame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type890 records

Wild obs. + sensor41

Museum / vouchered807

Other42

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 18≤1 km 5≤10 km 4>10 km 1

28 georeferenced · 13 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 176≤10 km 6>10 km 1

183 georeferenced · 624 without coordinates

Open the institutions mapphysical evidence807

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	506
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	108
Mexico City, MX	68
Tapachula, MX	17
South Kensington, GB	14
Area de Conservacion Guanacastelocation not on record	12
Colorado State Universitylocation not on record	7
University of Pennsylvanialocation not on record	1

8 institutions · 733 of 807 vouchered records shown · 74 without an institution code

09Environmental DNA177 detections

Where the DNA of Adeloneivaia isara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found177

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 177 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 24.4–26.2

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.6 °C 26.7–28.6

Min temp (night)23.6 °C 21.7–24.1

Precipitation151 mm/mo 151–328

Air humidity66.1 % 65.5–69.9

Moisture balance-11.9 mm/mo -11.9–199

Vapour deficit1,098 Pa 915–1,157

Wind speed4.10 m/s 1.90–4.10

Cloud cover29.0 % 21.9–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 176 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)