Adeloneivaia subangulata

Herrich-Schäffer, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Adeloneivaia

At a glance

Occurrence records311

Data sources6

Biological traits0

DNA specimens75

eDNA detections36

Sources6 archives

Databases and archives Adeloneivaia subangulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF311 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD75 specimens

01Narrative

Adeloneivaia subangulata is een vlinder uit de familie nachtpauwogen (Saturniidae), onderfamilie Ceratocampinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd door Herrich-Schäffer in 1855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adeloneivaia subangulata has left across the world's sequence archives.

At a glance

DNA specimens75

BINs2

Marker genes1

eDNA detections36

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

22Gvariable

40Tvariable

70Tvariable

124Cvariable

157Cvariable

217Tvariable

229Avariable

292Tmostly conserved

319Tmostly conserved

379Avariable

400Tmostly conserved

406Tvariable

508Avariable

514Cvariable

547Tvariable

550Amostly conserved

553Gvariable

601Tvariable

616Tvariable

646Cmostly conserved

653Tvariable

AACATTATATTTTATTTTTGGGATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTACTTATTCGAGCTGAATTAGGTACCCCCAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes20

BINs2

Most divergent pair3.2%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adeloneivaia pallidasame genus2.4%Adeloneivaia muellerisame genus2.4%Adeloneivaia ericisame genus3.1%Adeloneivaia antkozlovisame genus4.0%Adeloneivaia sabulosasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type311 records

Wild obs. + sensor206

Museum / vouchered101

Other4

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 93≤1 km 32≤10 km 18>10 km 12

155 georeferenced · 51 without coordinates

Open the mapobservation + sensor206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	34
University of Rouen, ECODIV Laboratorylocation not on record	15
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
Paris, FR	5
PUC-RSlocation not on record	5
Natural History Museum of Utahlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Tallinn, EE	2
New Haven, US	2
Ciudad de México, MX	1
Museu Paraense Emílio Goeldilocation not on record	1
South Kensington, GB	1

12 institutions · 81 of 101 vouchered records shown · 20 without an institution code

09Environmental DNA36 detections

Where the DNA of Adeloneivaia subangulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 21.6–24.9

Seasonal swing summer↔winter9.00 °C

Max temp (day)28.5 °C 26.2–29.8

Min temp (night)20.0 °C 18.1–20.6

Precipitation187 mm/mo 105–203

Air humidity62.2 % 60.3–64.4

Moisture balance27.4 mm/mo -32.4–84.8

Vapour deficit1,149 Pa 935–1,226

Wind speed1.80 m/s 1.70–3.40

Cloud cover45.0 % 27.6–54.1

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)