Adejeania vexatrix

(Osten Sacken, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Adejeania

At a glance

Occurrence records753

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Adejeania vexatrix's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility753 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF753 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Adejeania vexatrix is a species of fly in the family Tachinidae. It is found in western North America from Mexico to British Columbia. In addition to its bright orange abdomen and prominent, heavy black setae, this species is noted for its greatly elongated palpi, which stick straight forward from under the fly's head. A similar looking tachinid fly, Hystricia abrupta, is found in the eastern United States. It does not have the elongated mouthparts of A. vexatrix.Bugguide.net, Hystricia abrupta Paradejeania rutilioides also looks similar.Bugguide.net, Paradejeania rutilioides

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adejeania vexatrix has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

271Amostly conserved

313Cmostly conserved

562Amostly conserved

AACATTATATTTTATTTTTGGTGCATGATCCGGAATAGTAGGAACTTCTTTAAGAATTTTAGTTCGAGCTGAATTAGGACATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Protodejeania echinatasame family6.1%Protodejeania hystricosasame family6.2%Parepalpus labeosussame family6.4%Archytas californiaesame family6.5%Pararchytas decisussame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type753 records

Wild obs. + sensor708

Museum / vouchered45

Range

Area of Occupancy AOO2 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 349≤1 km 152≤10 km 44>10 km 37

582 georeferenced · 126 without coordinates

Open the mapobservation + sensor708

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 6≤10 km 13>10 km 4

23 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Awka, NG	8
Albuquerque, US	5
Budapest, HU	5
US	4
Cambridge, US	3
Natural History Museum of Utahlocation not on record	3
Colorado State Universitylocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Denver, US	2
Washington, US	2
München, DE	2
Universidad Católica de Manizaleslocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

13 institutions · 43 of 45 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Adejeania vexatrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Mixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–18.4

Seasonal swing summer↔winter26.8 °C

Max temp (day)24.2 °C 24.3–24.7

Min temp (night)11.1 °C 11.1–12.3

Precipitation59.8 mm/mo 59.8–105

Air humidity53.5 %

Moisture balance-80.1 mm/mo -80.1–-38.5

Vapour deficit965 Pa 965–986

Wind speed1.20 m/s 1.20–1.30

Cloud cover36.5 % 27.2–36.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)