Adalaria proxima

(Alder & Hancock, 1854) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Adalaria

At a glance

Occurrence records846

Data sources8

Biological traits6

DNA specimens78

eDNA detections205

Sources8 archives

Databases and archives Adalaria proxima's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility577 records↗

OBISOcean Biodiversity Information System269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI205 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS846 records

Environmental DNA3 datasets · 5 countries205 detections

DNA & barcodingBOLD78 specimens

01Narrative

Adalaria proxima is een slakkensoort uit de familie van de sterslakken (Onchidorididae). De wetenschappelijke naam van de soort werd in 1854 voor het eerst geldig gepubliceerd door Alder & Hancock.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max60 m

Depth min0 m

Vulnerability10

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adalaria proxima has left across the world's sequence archives.

At a glance

DNA specimens78

BINs2

Marker genes2

eDNA detections205

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

192Cmostly conserved

207Gmostly conserved

286Tmostly conserved

351Cvariable

432Gmostly conserved

486Gmostly conserved

555Amostly conserved

588Cmostly conserved

615Cmostly conserved

642Gmostly conserved

645Cmostly conserved

ACATTATATATTATTTTTGGTATATGGTGTGGACTTTTAGGAACTGGATTAAGATTACTTATTCGGTTTGAACTTGGAACAGCTGGGGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes22

BINs2

Most divergent pair16.6%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atalodoris sparsasame family11.5%Idaliadoris neapolitanasame family11.9%Acanthodoris pilosasame family14.0%Onchidoris evinctasame family14.0%Acanthodoris pinasame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type846 records

Wild obs. + sensor387

Museum / vouchered437

Other22

Range

Area of Occupancy AOO1 460 km²

Depth

0–200 m sunlit98

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 9.6 m · max 231 m · 99 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 305≤1 km 18≤10 km 5>10 km 8

336 georeferenced · 51 without coordinates

Open the mapobservation + sensor387

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 54≤1 km 43≤10 km 35>10 km 1

133 georeferenced · 304 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	35
CEFASlocation not on record	33
Bergen, NO	29
NTNU-VMlocation not on record	16
PNHSlocation not on record	14
CASlocation not on record	9
Victoria, CA	8
Gothenburg, SE	7
New Haven, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Washington, US	6
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	5
Maurice Lamontagne Institutelocation not on record	5
University Museum of Bergen, Natural History Collectionslocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
SLU Artdatabankenlocation not on record	2
Cambridge, US	1
Santa Barbara Museum of Natural Historylocation not on record	1
Hakai Institutelocation not on record	1
Saint John, CA	1

20 institutions · 191 of 437 vouchered records shown · 6 without an institution code

09Environmental DNA205 detections

Where the DNA of Adalaria proxima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found205

Studies independent surveys3

Countries5

Verifiable raw sequence linked158

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 205 detections have coordinates

Open the map5 countries0

Hard substrate (rocks)boulder fieldMacrocystis pyrifera forestOn kelpOn Kelpsheltered bay

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.20 °C -5.30–17.4

Seasonal swing summer↔winter22.7 °C

Max temp (day)9.40 °C -1.40–20.3

Min temp (night)4.20 °C -8.90–15.5

Precipitation110 mm/mo 89.3–166

Air humidity61.4 % 59.7–65.7

Moisture balance56.7 mm/mo -42.2–129

Vapour deficit369 Pa 165–684

Wind speed5.10 m/s 3.80–6.00

Cloud cover51.9 % 45.8–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 199 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)