Adalaria loveni

(Alder & Hancock, 1862) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Onchidorididae/Adalaria

At a glance

Occurrence records246

Data sources9

Biological traits2

DNA specimens13

eDNA detections4

Sources9 archives

Databases and archives Adalaria loveni's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility232 records↗

OBISOcean Biodiversity Information System14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF · OBIS246 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD13 specimens

01Narrative

Onchidoris loveni is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Onchidorididae.Bouchet, P. (2015). Onchidoris loveni. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-13 This species is found in the north-eastern parts of the Atlantic Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

03Chemical composition1 compounds

Compounds documented for Adalaria loveni across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cucurbitane triterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
1-[(1R,2S,5R,6R,7S,9R,10S,11S,13R)-7-hydroxy-10-(3-hydroxypropyl)-2,6,9-trimethyl-5-[(2R)-6-methylhept-5-en-2-yl]-12-oxatetracyclo[7.5.0.02,6.011,13]tetradecan-11-yl]ethanone		present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adalaria loveni has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P630 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

336Amostly conserved

519Gvariable

546Tmostly conserved

TGGTGTGGACTTTTAGGAACTGGATTAAGATTACTTATTCGGTTTGAACTTGGAACAGCTGGGGCTTTTTTAGGAGATGACCATTTTTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes3

BIN1

Most divergent pair0.48%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atalodoris sparsasame family11.9%Idaliadoris neapolitanasame family12.5%Acanthodoris luteasame family14.3%Onchidoris evinctasame family14.3%Acanthodoris hudsonisame family14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type246 records

Wild obs. + sensor148

Museum / vouchered97

Other1

Range

Area of Occupancy AOO348 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9.4 m · max 13.5 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 49≤1 km 13≤10 km 2

64 georeferenced · 84 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 55≤1 km 14≤10 km 4

73 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	52
Bergen, NO	16
DASSHlocation not on record	6
PNHSlocation not on record	6
CASlocation not on record	2
University Museum of Bergen, Natural History Collectionslocation not on record	1
Gothenburg, SE	1

7 institutions · 84 of 97 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Adalaria loveni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)