Actinotia radiosa

(Esper, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Actinotia

At a glance

Occurrence records535

Data sources6

Biological traits0

DNA specimens9

eDNA detections0

Sources6 archives

Databases and archives Actinotia radiosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility535 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF535 records

DNA & barcodingBOLD9 specimens

01Narrative

Actinotia radiosa is a moth in the family Noctuidae. It is found in southern Europe and the southern parts of central Europe, Anotolia, southern Russia, and the Caucasus region. In mountainous areas it is found up to heights of . The wingspan is . Adults are on wing from April to May and from July to August in two generations. There are mostly day active. Adults have been recorded feeding on flower nectar of various plants, including Vicia cracca, Salvia pratensis, Echium, Onobrychis, and Thymus. The larvae feed on the flowers and fruit of Hypericum species. They hide during the day.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinotia radiosa has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

85Tmostly conserved

100Tmostly conserved

379Cvariable

385Cvariable

400Cvariable

616Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes3

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinotia intermediatasame genus4.4%Actinotia polyodonsame genus5.0%Apamea oblongasame family5.9%Caradrina agrotinasame family5.9%Homorthodes reliquasame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type535 records

Wild obs. + sensor359

Museum / vouchered110

Other66

Origin

Native38

Range

Area of Occupancy AOO1 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 75≤1 km 37≤10 km 149>10 km 15

276 georeferenced · 83 without coordinates

Open the mapobservation + sensor359

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 1≤1 km 26≤10 km 62>10 km 4

93 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	24
Zürich, CH	11
Geneva, CH	10
Bern, CH	9
Archäologie und Museum Baselland - Museum.BLlocation not on record	4
Museum zu Allerheiligen Schaffhausenlocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Philadelphia, US	2
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Tartu, EE	2
UMUlocation not on record	2
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1

14 institutions · 75 of 110 vouchered records shown · 35 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)