Actinopyga varians

(Selenka, 1867) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Holothuriida/Holothuriidae/Actinopyga

At a glance

Occurrence records2 026

Data sources9

Biological traits4

DNA specimens5

eDNA detections6

Sources9 archives

Databases and archives Actinopyga varians's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 939 records↗

OBISOcean Biodiversity Information System87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 026 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Actinopyga varians, the Pacific white-spotted sea cucumber or Hawaiian sea cucumber, is a species of sea cucumber in the family Holothuriidae. It is found in the pacific Ocean near Hawai'i and also in the Indo-Pacific Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max25 m

Depth min0 m

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinopyga varians has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

187Cmostly conserved

490Tvariable

620Gmostly conserved

GACCCTTTACTTAATCTTTGGTGCCTGAGCAGGAATGGTAGGTACTGCAATGAGAGTTATTATTCGCACAGAACTAGCCCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinopyga mauritianasame genus12.3%Actinopyga lecanorasame genus13.7%Actinopyga obesasame genus14.4%Pentactella leoninasame order16.9%Araeosoma owstonisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 026 records

Wild obs. + sensor1 827

Museum / vouchered199

Range

Area of Occupancy AOO2 008 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.9 m · max 0.9 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 036≤1 km 410≤10 km 73>10 km 70

1 589 georeferenced · 238 without coordinates

Open the mapobservation + sensor1 827

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 1≤1 km 6≤10 km 1>10 km 3

11 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	77
Washington, US	32
Brussels, BE	3
University of Floridalocation not on record	1
Cambridge, US	1
Honolulu, US	1
RBINS-Scientific Heritagelocation not on record	1

7 institutions · 116 of 199 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Actinopyga varians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

barrier reef flatfouling marine mammal pens

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 20.1–23.6

Seasonal swing summer↔winter3.60 °C

Max temp (day)23.8 °C 22.7–25.0

Min temp (night)20.2 °C 18.1–22.4

Precipitation70.6 mm/mo 50.7–90.5

Air humidity65.7 % 59.7–71.8

Vapour deficit915 Pa 663–1,166

Cloud cover33.5 % 33.5–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Actinopyga varians

At a glance

Sources9 archives

Habitat & environment2

Other traits2

At a glance

Record type2 026 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 026 records