Actinopyga lecanora

(Jaeger, 1833) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Holothuriida/Holothuriidae/Actinopyga

At a glance

Occurrence records526

Data sources11

Biological traits5

DNA specimens11

eDNA detections11

Sources11 archives

Databases and archives Actinopyga lecanora's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility356 records↗

OBISOcean Biodiversity Information System170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Chemical compositionLOTUS · NPASS3 compounds

Occurrence & distributionGBIF · OBIS526 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Actinopyga lecanora, commonly known as the white-bottomed sea cucumber, is a species of sea cucumber in the family Holothuriidae. It is native to the tropical Western Indo-Pacific region and is harvested for food.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length25 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max23 m

Depth min20 m

03Chemical composition3 compounds

Compounds documented for Actinopyga lecanora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones1

Bauerane triterpenoids1

Lanostane, Tirucallane and Euphane triterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
[(2S,4S,5R,6S,9S,12R,13R,16S,18R)-2,6,13,17,17-pentamethyl-6-(4-methylpentyl)-8-oxo-16-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-7-oxapentacyclo[10.8.0.02,9.05,9.013,18]icos-1(20)-en-4-yl] acetate	present	LOTUS
Bauerenyl acetate	present	NPASS
Eupatilin	present	NPASS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinopyga lecanora has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

4Tmostly conserved

13Tmostly conserved

49Amostly conserved

64Cmostly conserved

103Tmostly conserved

115Cmostly conserved

139Cmostly conserved

154Cmostly conserved

172Cmostly conserved

187Cmostly conserved

196Gmostly conserved

208Gmostly conserved

235Cmostly conserved

277Cmostly conserved

281Gmostly conserved

287Cvariable

290Cmostly conserved

298Cmostly conserved

307Amostly conserved

310Amostly conserved

337Tmostly conserved

340Tmostly conserved

343Amostly conserved

367Cmostly conserved

406Tmostly conserved

418Cmostly conserved

424Amostly conserved

442Tmostly conserved

445Tmostly conserved

454Gvariable

457Cmostly conserved

463Cmostly conserved

484Cmostly conserved

490Cmostly conserved

496Cmostly conserved

499Tmostly conserved

505Cmostly conserved

511Amostly conserved

520Tvariable

539Tmostly conserved

544Amostly conserved

548Cmostly conserved

556Tmostly conserved

559Amostly conserved

565Cmostly conserved

589Cmostly conserved

592Amostly conserved

601Amostly conserved

616Cmostly conserved

628Amostly conserved

634Cmostly conserved

637Tmostly conserved

646Cmostly conserved

652Tmostly conserved

655Gmostly conserved

AACTCTCTATCTTATATTTGGTGCCTGAGCAGGAATGGTGGGTACCGCAATGAGAGTTATTATCCGAACAGAATTAGCTCAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes3

BINs2

Most divergent pair8.1%

OtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinopyga varianssame genus13.7%Actinopyga obesasame genus14.0%Actinopyga spineasame genus14.1%Holothuria albofuscasame family16.6%Holothuria arenicolasame family16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_057223 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND4LCOX2ATP8ATP6COX3ND3ND4ND5ND6CYTBND1ND2rrnSrrnL

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type526 records

Wild obs. + sensor364

Museum / vouchered161

Other1

Range

Area of Occupancy AOO880 km²

Depth

0–200 m sunlit16

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9 m · max 16 m · 16 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 121≤1 km 82≤10 km 36>10 km 15

254 georeferenced · 110 without coordinates

Open the mapobservation + sensor364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 12≤1 km 27≤10 km 17>10 km 5

61 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	21
Sydney, AU	12
Western Australian Museumlocation not on record	9
Cambridge, US	7
Brussels, BE	6
RBINS-Scientific Heritagelocation not on record	4
Paris, FR	3
Mutare Museumlocation not on record	3
Natick, US	3
Museum and Art Gallery of the Northern Territorylocation not on record	2
Museums Victorialocation not on record	2
Washington, US	2
Australian Institute of Marine Sciencelocation not on record	2
Davao del Norte State Collegelocation not on record	1
Ifremerlocation not on record	1

15 institutions · 78 of 161 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Actinopyga lecanora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.4–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.5 °C 25.9–26.5

Min temp (night)24.9 °C 24.8–24.9

Precipitation101 mm/mo 92.9–101

Air humidity63.0 % 61.7–63.0

Vapour deficit1,215 Pa 1,215–1,236

Cloud cover40.4 % 40.4–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)