Actinopyga echinites

(Jaeger, 1833) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Holothuriida/Holothuriidae/Actinopyga

At a glance

Occurrence records882

Data sources14

Biological traits3

DNA specimens16

eDNA detections14

Sources14 archives

Databases and archives Actinopyga echinites's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility587 records↗

OBISOcean Biodiversity Information System295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF · OBIS882 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI≈949 Mbp

01Narrative

Actinopyga echinites, commonly known as the brownfish or deep water redfish, is a species of sea cucumber in the family Holothuriidae. It is native to the tropical Indo-Pacific region and is harvested for food.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length15 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition10 compounds

Compounds documented for Actinopyga echinites across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavones4

Lanostane, Tirucallane and Euphane triterpenoids2

Flavonols2

Oleanane triterpenoids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
3,5-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS
5-hydroxy-2-(3-hydroxy-4-methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS
7-[(2R,3S,4S,5R,6S)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
[(3R,4R,5R,6S)-5-[(2S,3R,4R,5S,6R)-5-[(2S,3R,4S,5R,6R)-4-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-methoxyoxan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-6-[[(1S,2S,5R,6S,9S,10S,13S,16S,18R)-5,10-dihydroxy-2,6,13,17,17-pentamethyl-6-(4-methylpentyl)-8-oxo-7-oxapentacyclo[10.8.0.02,9.05,9.013,18]icos-11-en-16-yl]oxy]-4-hydroxyoxan-3-yl] hydrogen sulfate	present	LOTUS
[(3R,4R,5R,6S)-6-[[(1S,2S,5R,6S,9S,10S,13S,16S,18R)-5,10-dihydroxy-2,6,13,17,17-pentamethyl-6-(4-methylpentyl)-8-oxo-7-oxapentacyclo[10.8.0.02,9.05,9.013,18]icos-11-en-16-yl]oxy]-4-hydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] hydrogen sulfate	present	LOTUS
Apigenin	present	NPASS
GZSOSUNBTXMUFQ-SRSKTEPCSA-N	present	NPASS
Luteolin 7-glucoside	present	NPASS
Oleanolic acid	present	NPASS
Quercetin 7-glucoside	present	NPASS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinopyga echinites has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

19Amostly conserved

31Cvariable

52Amostly conserved

73Gvariable

163Cmostly conserved

218Cmostly conserved

244Tvariable

331Cvariable

431Gmostly conserved

442Amostly conserved

443Gmostly conserved

444Amostly conserved

505Cvariable

549Gmostly conserved

551Gmostly conserved

AAAATGACTTATTCCACTAATGATTGGAGCCCCAGATATGGCTTTTCCACGAATGAAAAAAATGAGATTCTGGCTAGTCCCACCTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes4

BIN1

Most divergent pair1.1%

AfricaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinopyga spineasame genus9.8%Actinopyga obesasame genus13.6%Actinopyga bannwarthisame genus14.7%Actinopyga mauritianasame genus14.8%Actinopyga varianssame genus14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Actinopyga echinites carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈948 570 139 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Actinopyga echinites0.95 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness11.4% BUSCO

08Occurrence & distribution

Record type882 records

Wild obs. + sensor564

Museum / vouchered314

Other4

Range

Area of Occupancy AOO1 600 km²

Depth

0–200 m sunlit99

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 13 m · max 400 m · 100 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 87≤1 km 16≤10 km 19>10 km 253

375 georeferenced · 189 without coordinates

Open the mapobservation + sensor564

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 28≤1 km 35≤10 km 28>10 km 18

109 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence314

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	42
Brussels, BE	27
Sydney, AU	21
Washington, US	18
Paris, FR	17
RBINS-Scientific Heritagelocation not on record	17
Museum and Art Gallery of the Northern Territorylocation not on record	8
Cambridge, US	6
Natick, US	6
Western Australian Museumlocation not on record	5
CASlocation not on record	2
Australian Institute of Marine Sciencelocation not on record	2
Honolulu, US	2
Holy Name Universitylocation not on record	1
Museums Victorialocation not on record	1
Royal Museum for Central Africalocation not on record	1
Florida Museum of Natural Historylocation not on record	1

17 institutions · 177 of 314 vouchered records shown · 6 without an institution code

09Environmental DNA14 detections

Where the DNA of Actinopyga echinites was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.3 °C 27.0–27.5

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.1 °C 27.8–28.4

Min temp (night)26.3 °C 26.1–26.5

Precipitation180 mm/mo 92.9–268

Air humidity63.5 % 62.9–64.1

Vapour deficit1,317 Pa 1,277–1,358

Cloud cover30.6 % 23.5–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)