Actia lamia

(Meigen, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Actia

At a glance

Occurrence records1 261

Data sources7

Biological traits0

DNA specimens107

eDNA detections360

Sources7 archives

Databases and archives Actia lamia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI360 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics107 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 261 records

Environmental DNA3 datasets · 9 countries360 detections

DNA & barcodingBOLD107 specimens

01Narrative

Actia lamia is the type species of the genus Actia of the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding107 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actia lamia has left across the world's sequence archives.

At a glance

DNA specimens107

BINs1

Marker genes1

eDNA detections360

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

392Cmostly conserved

422Gmostly conserved

CATTGTATTTTATTTTTGGAGCCTGATCAGGAATATTAGGAACATCATTAAGTTTACTAATTCGAGCTGAGTTAGGACATCCTGGAGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes8

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actia pilipennissame genus6.4%Actia interruptasame genus7.8%Actia autumnalissame genus8.9%Actia maksymovisame genus9.2%Actia infantulasame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 261 records

Wild obs. + sensor691

Museum / vouchered551

Other19

Range

Area of Occupancy AOO2 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 465≤1 km 165≤10 km 46>10 km 2

678 georeferenced · 13 without coordinates

Open the mapobservation + sensor691

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 485≤1 km 46≤10 km 5

536 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence551

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	17
University of Tokyo, Department of Zoologylocation not on record	15
SLU Artdatabankenlocation not on record	13
NHMOlocation not on record	12
South Kensington, GB	7
Norwegian Institute for Nature Researchlocation not on record	3
Provincia di Livornolocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
DFFW2018location not on record	1
Gothenburg, SE	1
Tromsø, NO	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NCMGlocation not on record	1
neflocation not on record	1

14 institutions · 78 of 551 vouchered records shown · 473 without an institution code

09Environmental DNA360 detections

Where the DNA of Actia lamia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found360

Studies independent surveys3

Countries9

Verifiable raw sequence linked272

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 360 detections have coordinates

Open the map9 countries0

UrbanHay meadowForest edge (suburban)Garden lawn14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.1–17.0

Seasonal swing summer↔winter18.5 °C

Max temp (day)18.7 °C 15.2–20.9

Min temp (night)10.7 °C 7.00–13.2

Precipitation83.2 mm/mo 51.6–105

Air humidity60.0 % 57.3–61.8

Moisture balance-29.6 mm/mo -60.6–6.40

Vapour deficit677 Pa 560–779

Wind speed2.80 m/s 2.20–4.10

Cloud cover48.3 % 37.6–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 360 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Actia lamia

At a glance

Sources7 archives

At a glance

Record type1 261 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 261 records