Actia infantula

(Zetterstedt, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Actia

At a glance

Occurrence records104

Data sources7

Biological traits0

DNA specimens47

eDNA detections57

Sources7 archives

Databases and archives Actia infantula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF104 records

Environmental DNA3 datasets · 10 countries57 detections

DNA & barcodingBOLD47 specimens

01Narrative

Actia infantula is a Palearctic species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actia infantula has left across the world's sequence archives.

At a glance

DNA specimens47

BINs2

Marker genes1

eDNA detections57

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

2Tmostly conserved

288Tvariable

293Amostly conserved

341Amostly conserved

518Cmostly conserved

569Tmostly conserved

614Cvariable

632Tmostly conserved

CTCTATATTTTATTTTTGGTGCATGATCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAACTAGGACATCCAGGAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes8

BINs2

Most divergent pair7.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actia pilipennissame genus8.1%Actia maksymovisame genus8.4%Actia dimorphasame genus9.0%Actia nigroscutellatasame genus9.2%Actia interruptasame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type104 records

Wild obs. + sensor63

Museum / vouchered41

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 45≤1 km 7≤10 km 11

63 georeferenced

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 28≤1 km 8≤10 km 1

37 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	28
Helsinki, FI	3
South Kensington, GB	2
Bavarian State Collection of Zoologylocation not on record	1

4 institutions · 34 of 41 vouchered records shown · 7 without an institution code

09Environmental DNA57 detections

Where the DNA of Actia infantula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys3

Countries10

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map10 countries0

Urban1.1. Boreal Forest|1. Forest & Woodland14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 10.6–20.2

Seasonal swing summer↔winter20.2 °C

Max temp (day)20.2 °C 13.3–24.4

Min temp (night)11.1 °C 6.10–15.1

Precipitation71.7 mm/mo 49.7–121

Air humidity60.0 % 55.7–61.5

Moisture balance-24.4 mm/mo -75.7–25.6

Vapour deficit738 Pa 500–1,060

Wind speed2.70 m/s 2.00–4.10

Cloud cover40.1 % 35.2–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)