Acrossocheilus microstoma

Animalia/Chordata/Cypriniformes/Cyprinidae/Acrossocheilus

At a glance

Occurrence records0

Data sources6

Biological traits3

DNA specimens4

eDNA detections7

Sources6 archives

Databases and archives Acrossocheilus microstoma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acrossocheilus microstoma is a species of cyprinid fish native to freshwater in northwestern Vietnam. It has sometimes included in A. iridescens as a subspecies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability11.13

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrossocheilus microstoma has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P544 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.46%

Haplotypes2

BIN1

Most divergent pair0.92%

Where individuals differ — all 5 variable positions, in barcode order

69Gmostly conserved

132Amostly conserved

165Tmostly conserved

180Amostly conserved

225Amostly conserved

CTAATTCGGGCCGAGCTAAGTCAACCCGGGTCACTTCTAGGTGATGATCAAATCTATAATGTTATCGTGACCGCCCACGCCTTTGTTATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrossocheilus longipinnissame genus1.9%Onychostoma brevibarbasame family8.8%Acrossocheilus jishouensissame genus9.0%Acrossocheilus hemispinussame genus9.4%Acrossocheilus wenchowensissame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

09Environmental DNA7 detections

Where the DNA of Acrossocheilus microstoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.