Acrossocheilus wenchowensis

Wang, 1935 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Acrossocheilus

At a glance

Occurrence records30

Data sources10

Biological traits6

DNA specimens36

eDNA detections26

Sources10 archives

Databases and archives Acrossocheilus wenchowensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

OBISOcean Biodiversity Information System9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS30 records

Environmental DNA1 datasets · 0 countries26 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈971 Mbp

01Narrative

Acrossocheilus wenchowensis is a species of ray-finned fish in the genus Acrossocheilus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15.5 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrossocheilus wenchowensis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes11

eDNA detections26

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P677 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

49Tmostly conserved

96Amostly conserved

117Tmostly conserved

177Cmostly conserved

180Amostly conserved

210Amostly conserved

213Cmostly conserved

249Tmostly conserved

267Amostly conserved

273Amostly conserved

282Amostly conserved

294Tmostly conserved

303Tmostly conserved

312Tmostly conserved

327Amostly conserved

346Tmostly conserved

363Cmostly conserved

405Cmostly conserved

462Cmostly conserved

474Amostly conserved

537Tmostly conserved

552Tmostly conserved

561Cmostly conserved

618Gmostly conserved

624Gmostly conserved

627Amostly conserved

630Gmostly conserved

651Cmostly conserved

666Cmostly conserved

669Amostly conserved

672Tmostly conserved

675Tmostly conserved

ACCCTTTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGAACTGCCTTAAGCCTCCTAATTCGGGCCGAGCTTAGTCAACCCGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes5

BINs2

Most divergent pair4.9%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrossocheilus fasciatussame genus4.1%Acrossocheilus kreyenbergiisame genus4.3%Acrossocheilus hemispinussame genus6.1%Acrossocheilus parallenssame genus6.5%Acrossocheilus jishouensissame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_020145 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acrossocheilus wenchowensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈971 289 456 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acrossocheilus wenchowensis0.97 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type30 records

Wild obs. + sensor11

Museum / vouchered19

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 5≤1 km 1≤10 km 2>10 km 2

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 19 records without

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FishBaselocation not on record	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Chicago, US	1

3 institutions · 10 of 19 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Acrossocheilus wenchowensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)