Acropolitis rudisana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acropolitis

At a glance

Occurrence records437

Data sources7

Biological traits0

DNA specimens112

eDNA detections111

Sources7 archives

Databases and archives Acropolitis rudisana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility437 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI111 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics112 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF437 records

Environmental DNA1 datasets · 1 countries111 detections

DNA & barcodingBOLD112 specimens

01Narrative

Acropolitis rudisana is a moth of the family Tortricidae. It is widespread in eastern Australia. The wingspan is about 17 mm. The forewings are grey, with fuscous markings and irrorations (speckles). The hindwings are grey.New Australian Lepidoptera of the Family Tortricidae The larvae feed on Vitis, Acacia, Arctotheca, Chrysanthemum, Hakea, Helichrysum, Malus, Pinus, Populus, Pyracantha and Rumex species, as well as Dillwynia retorta, Dimocarpus longan, Humulus lupulus, Medicago sativa, Rubus loganobaccus and Trifolium repens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding112 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acropolitis rudisana has left across the world's sequence archives.

At a glance

DNA specimens112

BINs1

Marker genes2

eDNA detections111

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus96 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

40Gmostly conserved

148Avariable

250Cmostly conserved

433Gmostly conserved

616Cmostly conserved

646Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTGGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes40

BIN1

Most divergent pair1.4%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acropolitis excelsasame genus5.9%Acropolitis ptychosemasame genus6.8%Choristoneura albanianasame family7.0%Clepsis melaleucanussame family7.3%Argyrotaenia lautanasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type437 records

Wild obs. + sensor375

Museum / vouchered62

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 215≤1 km 21≤10 km 4>10 km 10

250 georeferenced · 125 without coordinates

Open the mapobservation + sensor375

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 10≤1 km 2≤10 km 6

18 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	16
DPIlocation not on record	10
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Australian National Insect Collectionlocation not on record	1
Australian National Fish Collectionlocation not on record	1

5 institutions · 29 of 62 vouchered records shown · 19 without an institution code

09Environmental DNA111 detections

Where the DNA of Acropolitis rudisana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found111

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 111 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 9.30–18.4

Seasonal swing summer↔winter14.5 °C

Max temp (day)18.5 °C 12.9–23.7

Min temp (night)7.00 °C 5.40–15.2

Precipitation62.3 mm/mo 26.1–65.0

Air humidity57.2 % 55.3–60.7

Moisture balance-49.7 mm/mo

Vapour deficit634 Pa 480–957

Wind speed3.00 m/s

Cloud cover20.4 % 20.1–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 110 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)