Acropolitis excelsa

Meyrick, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acropolitis

At a glance

Occurrence records52

Data sources7

Biological traits0

DNA specimens56

eDNA detections55

Sources7 archives

Databases and archives Acropolitis excelsa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF52 records

Environmental DNA1 datasets · 1 countries55 detections

DNA & barcodingBOLD56 specimens

01Narrative

Acropolitis excelsa is a moth of the family Tortricidae. It is found in Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acropolitis excelsa has left across the world's sequence archives.

At a glance

DNA specimens56

BINs1

Marker genes1

eDNA detections55

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

127Tvariable

178Cvariable

382Tvariable

412Cmostly conserved

433Gmostly conserved

460Tvariable

577Avariable

607Cmostly conserved

616Tmostly conserved

628Gvariable

634Cvariable

646Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGACTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes26

BIN1

Most divergent pair1.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acropolitis ptychosemasame genus4.7%Acropolitis rudisanasame genus5.9%Acropolitis magnanasame genus6.1%Acropolitis ergophorasame genus6.5%Thrincophora signigeranasame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type52 records

Wild obs. + sensor40

Museum / vouchered12

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 2

10 georeferenced · 30 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	3
DPIlocation not on record	3
Australian National Insect Collectionlocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1
Sydney, AU	1
Museums Victorialocation not on record	1

6 institutions · 10 of 12 vouchered records shown · 2 without an institution code

09Environmental DNA55 detections

Where the DNA of Acropolitis excelsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map1 country0

1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.8–13.0

Seasonal swing summer↔winter14.5 °C

Max temp (day)18.5 °C

Min temp (night)7.00 °C 7.00–7.90

Precipitation63.5 mm/mo

Air humidity57.2 %

Moisture balance-49.7 mm/mo

Vapour deficit634 Pa

Wind speed2.50 m/s

Cloud cover20.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)