Acronicta impleta

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records2 738

Data sources7

Biological traits0

DNA specimens52

eDNA detections53

Sources7 archives

Databases and archives Acronicta impleta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 738 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 738 records

Environmental DNA1 datasets · 2 countries53 detections

DNA & barcodingBOLD52 specimens

01Narrative

Acronicta impleta, the yellow-haired dagger moth, is a moth of the family Noctuidae. It is found in most of North America. The wingspan is about 42 mm. Adults are on wing from April to July depending on the location. The larvae feed on Ulmus, Acer, Betula, Salix and Quercus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta impleta has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections53

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

73Gmostly conserved

265Tmostly conserved

400Cmostly conserved

526Tmostly conserved

542Tmostly conserved

562Tmostly conserved

643Cmostly conserved

AACATTATACTTCATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAGTTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes14

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta rumicissame genus5.3%Acronicta menyanthidissame genus5.3%Acronicta noctivagasame genus5.5%Acronicta dollisame genus5.8%Acronicta euphorbiaesame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 738 records

Wild obs. + sensor2 146

Museum / vouchered592

Range

Area of Occupancy AOO7 920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 169≤1 km 283≤10 km 176>10 km 184

1 812 georeferenced · 334 without coordinates

Open the mapobservation + sensor2 146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 48≤1 km 80≤10 km 155>10 km 21

304 georeferenced · 288 without coordinates

Open the institutions mapphysical evidence592

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	130
University of Alberta Museums (UAM)location not on record	91
Colorado State Universitylocation not on record	67
East Lansing, US	59
New Haven, US	58
Oregon State Arthropod Collectionlocation not on record	36
Royal Saskatchewan Museumlocation not on record	23
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
St. Paul, US	11
Georgia Museum of Natural Historylocation not on record	11
CUlocation not on record	10
Vernal, US	7
OSUClocation not on record	6
UNHClocation not on record	5
King Saud Universitylocation not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
UDlocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Toronto, CA	2
Champaign, US	2
University of California, Davislocation not on record	2
Santa Cruz, US	2
SOVTlocation not on record	2
Washington, US	2
North Carolina State University Insect Museumlocation not on record	1
WWUlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Decorah, US	1
San Francisco, US	1

30 institutions · 560 of 592 vouchered records shown · 32 without an institution code

09Environmental DNA53 detections

Where the DNA of Acronicta impleta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1. Boreal ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 13.6–22.5

Seasonal swing summer↔winter24.2 °C

Max temp (day)22.4 °C 17.9–28.2

Min temp (night)11.9 °C 8.80–18.6

Precipitation105 mm/mo 63.9–141

Air humidity58.7 % 53.9–62.7

Moisture balance-31.8 mm/mo -80.6–3.50

Vapour deficit801 Pa 637–1,167

Wind speed2.90 m/s 1.10–4.40

Cloud cover40.3 % 27.4–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta impleta

At a glance

Sources7 archives

At a glance

Record type2 738 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 738 records