Acronicta funeralis

Grote & Robinson, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 335

Data sources7

Biological traits0

DNA specimens29

eDNA detections29

Sources7 archives

Databases and archives Acronicta funeralis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 335 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 335 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD29 specimens

01Narrative

Acronicta funeralis, the funerary dagger moth or paddle caterpillar, is a moth of the family Noctuidae. The species was first described by Augustus Radcliffe Grote and Coleman Townsend Robinson in 1866. It has a scattered distribution. It is found in North America from Manitoba to Nova Scotia, south to Maryland. It is also found in Georgia, Mississippi, Texas, and along the west-coast from California to British Columbia. The wingspan is 32–40 mm. Adults are on wing from May to August depending on the location. It has two or more generations per year in the south and one or two in the north. The larvae feed on leaves of alder, apple, birch, blueberry and huckleberry, cottonwood, dogwood, elm, hazel, hickory, maple, oak and willow. Acronicta funeralis larva, advanced instar

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta funeralis has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes1

BIN1

AACACTATACTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCCCTAAGATTACTAATTCGAGCAGAATTAGGAACCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta alnisame genus5.6%Stilbia calberlaesame family6.6%Acronicta auricomasame genus7.0%Acronicta strigosasame genus7.1%Resapamea hedenisame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 335 records

Wild obs. + sensor1 058

Museum / vouchered277

Range

Area of Occupancy AOO3 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 582≤1 km 125≤10 km 73>10 km 102

882 georeferenced · 176 without coordinates

Open the mapobservation + sensor1 058

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 2≤1 km 44≤10 km 102>10 km 6

154 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	68
Mississippi State, US	57
North Carolina State University Insect Museumlocation not on record	34
University of Alberta Museums (UAM)location not on record	21
New Haven, US	15
Oregon State Arthropod Collectionlocation not on record	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Vernal, US	7
Colorado State Universitylocation not on record	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
St. Paul, US	5
Brussels, BE	3
Philadelphia, US	2
Toronto, CA	2
OSUClocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Chicago, US	1
Natural History Museum of Utahlocation not on record	1
Washington, US	1
Essig Museum of Entomologylocation not on record	1
SOVTlocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Cambridge, US	1
Denver, US	1
UNHClocation not on record	1

25 institutions · 255 of 277 vouchered records shown · 22 without an institution code

09Environmental DNA29 detections

Where the DNA of Acronicta funeralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

Mixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 15.3–19.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.0 °C 20.1–23.6

Min temp (night)13.2 °C 10.6–16.4

Precipitation86.9 mm/mo 72.5–113

Air humidity59.5 % 57.0–62.7

Moisture balance-44.4 mm/mo -60.4–-13.5

Vapour deficit836 Pa 716–892

Wind speed3.20 m/s 2.40–3.90

Cloud cover47.3 % 35.2–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta funeralis

At a glance

Sources7 archives

At a glance

Record type1 335 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 335 records