Acronicta strigosa

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records12 834

Data sources7

Biological traits2

DNA specimens49

eDNA detections24

Sources7 archives

Databases and archives Acronicta strigosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 834 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF12 834 records

Environmental DNA1 datasets · 4 countries24 detections

DNA & barcodingBOLD49 specimens

01Narrative

Acronicta strigosa, the marsh dagger, is a moth of the family Noctuidae. It is distributed through most of Europe, east to the Caucasus, northern China, Korea and Japan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta strigosa has left across the world's sequence archives.

At a glance

DNA specimens49

BINs3

Marker genes15

eDNA detections24

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

43Tmostly conserved

46Cmostly conserved

49Cmostly conserved

79Amostly conserved

85Cmostly conserved

136Tmostly conserved

139Cmostly conserved

169Tmostly conserved

181Amostly conserved

206Tmostly conserved

232Tmostly conserved

238Tmostly conserved

268Tmostly conserved

274Amostly conserved

283Cmostly conserved

287Tmostly conserved

340Tmostly conserved

364Cmostly conserved

376Amostly conserved

385Cmostly conserved

400Tmostly conserved

406Cmostly conserved

433Amostly conserved

436Amostly conserved

439Tmostly conserved

451Amostly conserved

517Gvariable

526Tmostly conserved

533Tmostly conserved

539Tmostly conserved

542Tmostly conserved

553Tmostly conserved

562Gmostly conserved

581Cmostly conserved

613Cmostly conserved

616Tmostly conserved

622Cmostly conserved

625Amostly conserved

640Tmostly conserved

641Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACCTCCTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes4

BINs3

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta adauctasame genus4.1%Bryophila tephrocharissame family4.7%Simyra dentinosasame family4.7%Resapamea hedenisame family5.0%Pseudorthodes vecorssame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND612SMT-NADH5

animal barcoderibosomalmitochondrialmarker

08Occurrence & distribution

Record type12 834 records

Wild obs. + sensor10 312

Museum / vouchered2 473

Other49

Origin

Native102

Range

Area of Occupancy AOO8 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 4 496≤1 km 2 624≤10 km 2 484>10 km 143

9 747 georeferenced · 565 without coordinates

Open the mapobservation + sensor10 312

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 846≤1 km 460≤10 km 898>10 km 24

2 228 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence2 473

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 232
Helsinki, FI	225
Tartu, EE	82
Muzeum Górnośląskie w Bytomiulocation not on record	62
Adam Mickiewicz University in Poznańlocation not on record	28
Philadelphia, US	26
Uniwersytet Łódzkilocation not on record	24
Salzburg, AT	24
Tallinn, EE	23
Metsähallituslocation not on record	23
Zürich, CH	22
Kuopio, FI	19
SLU Artdatabankenlocation not on record	16
ZMAAlocation not on record	15
Frauenfeld, CH	12
MZLUlocation not on record	9
Provincia di Livornolocation not on record	9
DABUHlocation not on record	9
SFRAlocation not on record	7
Nijmegen, NL	6
ZSMlocation not on record	6
Paro, BT	4
Bern, CH	4
Naturmuseum St. Gallenlocation not on record	4
NCMGlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
МПХУlocation not on record	3
NHMOlocation not on record	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
ННПМ НАНУlocation not on record	2
ИЗШ НАНУlocation not on record	2
John May Museum of Natural Historylocation not on record	2
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
New Haven, US	1
EGBlocation not on record	1
Research Collection of Rudolf Tannertlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
CBDClocation not on record	1
ЗМКУlocation not on record	1
Podgorica, ME	1
Stockholm, SE	1

42 institutions · 1 922 of 2 473 vouchered records shown · 551 without an institution code

09Environmental DNA24 detections

Where the DNA of Acronicta strigosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map4 countries0

inside forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 9.70–18.8

Seasonal swing summer↔winter18.8 °C

Max temp (day)20.1 °C 13.4–23.2

Min temp (night)11.3 °C 4.80–13.8

Precipitation81.5 mm/mo 58.4–204

Air humidity59.4 % 58.3–64.2

Moisture balance-22.8 mm/mo -65.5–84.3

Vapour deficit731 Pa 486–903

Wind speed3.20 m/s 2.40–3.90

Cloud cover36.6 % 33.4–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta strigosa

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type12 834 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 834 records