Acronicta fragilis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 044

Data sources7

Biological traits0

DNA specimens56

eDNA detections55

Sources7 archives

Databases and archives Acronicta fragilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 044 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 044 records

Environmental DNA1 datasets · 2 countries55 detections

DNA & barcodingBOLD56 specimens

01Narrative

Acronicta fragilis, the fragile dagger moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in North America from Newfoundland to Florida, west across Canada, south to Kentucky and Minnesota. It is listed as a species of special concern in the US state of Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved January 27, 2018. The wingspan is about 30 mm. Adults are on wing from June to July depending on the location. The larvae feed on apple, birch, plum, willow, and white spruce.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta fragilis has left across the world's sequence archives.

At a glance

DNA specimens56

BINs2

Marker genes1

eDNA detections55

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

25Cmostly conserved

31Amostly conserved

61Gmostly conserved

124Cmostly conserved

206Cmostly conserved

220Cmostly conserved

406Tmostly conserved

470Cmostly conserved

478Cmostly conserved

481Amostly conserved

496Gmostly conserved

508Cmostly conserved

514Gmostly conserved

542Cmostly conserved

553Cmostly conserved

581Tmostly conserved

586Gmostly conserved

589Tmostly conserved

613Tmostly conserved

616Tmostly conserved

622Tmostly conserved

625Amostly conserved

628Amostly conserved

643Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATCTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTGATTCGAGCAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes11

BINs2

Most divergent pair3.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta heitzmanisame genus1.7%Resapamea hedenisame family5.9%Mazuca elegantissimasame family6.4%Stilbia calberlaesame family6.4%Acronicta strigosasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 044 records

Wild obs. + sensor588

Museum / vouchered456

Range

Area of Occupancy AOO2 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 331≤1 km 67≤10 km 22>10 km 25

445 georeferenced · 143 without coordinates

Open the mapobservation + sensor588

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 19≤1 km 51≤10 km 75>10 km 5

150 georeferenced · 306 without coordinates

Open the institutions mapphysical evidence456

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	162
East Lansing, US	56
Colorado State Universitylocation not on record	31
Royal Saskatchewan Museumlocation not on record	28
New Haven, US	23
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
Oregon State Arthropod Collectionlocation not on record	17
Mississippi State, US	12
ASUlocation not on record	10
Vernal, US	8
Brussels, BE	8
St. Paul, US	7
Saint John, CA	5
Cambridge, US	4
RBINS-Scientific Heritagelocation not on record	4
Georgia Museum of Natural Historylocation not on record	3
Philadelphia, US	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Chicago, US	2
Toronto, CA	2
Washington, US	1
WWUlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
SOVTlocation not on record	1

25 institutions · 412 of 456 vouchered records shown · 44 without an institution code

09Environmental DNA55 detections

Where the DNA of Acronicta fragilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map2 countries0

ForestGrassland1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 12.3–19.4

Seasonal swing summer↔winter24.1 °C

Max temp (day)20.3 °C 16.4–23.6

Min temp (night)12.1 °C 7.50–16.4

Precipitation97.8 mm/mo 60.9–154

Air humidity60.3 % 56.7–63.6

Moisture balance-27.1 mm/mo -57.1–14.7

Vapour deficit699 Pa 557–866

Wind speed2.70 m/s 1.10–3.90

Cloud cover46.0 % 30.5–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta fragilis

At a glance

Sources7 archives

At a glance

Record type1 044 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 044 records