Acronicta cinerea

(Hufnagel, 1766) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records5 872

Data sources7

Biological traits0

DNA specimens10

eDNA detections1

Sources7 archives

Databases and archives Acronicta cinerea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 872 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 872 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acronicta cinerea is a moth of the family Noctuidae. It is found from northern Germany, Poland, Slovakia, the Czech Republic, the Baltic, Norway, southern Finland, Belarus, Ukraine, western Russia up to Uralsk and Guberli. Some authors consider Acronicta cinerea a synonym of Acronicta euphorbiae

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta cinerea has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 2 variable positions, in barcode order

523Cmostly conserved

598Amostly conserved

AACATTATATTTTATCTTTGGTATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta lanceolariasame genus5.5%Resapamea hedenisame family5.5%Acronicta impressasame genus5.8%Acronicta impletasame genus5.9%Acronicta lupinisame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 872 records

Wild obs. + sensor4 173

Museum / vouchered1 699

Range

Area of Occupancy AOO7 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 1 034≤1 km 1 563≤10 km 1 517>10 km 33

4 147 georeferenced · 26 without coordinates

Open the mapobservation + sensor4 173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 423≤1 km 376≤10 km 804>10 km 38

1 641 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence1 699

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	883
Helsinki, FI	365
NHMOlocation not on record	84
SLU Artdatabankenlocation not on record	39
Tartu, EE	34
ZMAAlocation not on record	34
NTNU-VMlocation not on record	33
CBDClocation not on record	11
Tromsø, NO	10
Adam Mickiewicz University in Poznańlocation not on record	10
NCMGlocation not on record	9
Uniwersytet Łódzkilocation not on record	9
Kuopio, FI	8
Tallinn, EE	7
MZLUlocation not on record	6
Zürich, CH	4
Philadelphia, US	4
NMBU:MINAlocation not on record	2
BioFokuslocation not on record	1
Rovaniemi, FI	1
Bavarian State Collection of Zoologylocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

22 institutions · 1 556 of 1 699 vouchered records shown · 143 without an institution code

09Environmental DNA1 detections

Where the DNA of Acronicta cinerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 9.10–9.10

Seasonal swing summer↔winter18.8 °C

Max temp (day)13.4 °C

Min temp (night)4.20 °C

Precipitation33.5 mm/mo

Air humidity58.0 %

Moisture balance-36.4 mm/mo

Vapour deficit486 Pa

Wind speed2.60 m/s

Cloud cover40.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta cinerea

At a glance

Sources7 archives

At a glance

Record type5 872 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 872 records