Acroneuria carolinensis

(Banks, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Perlidae/Acroneuria

At a glance

Occurrence records1 384

Data sources7

Biological traits0

DNA specimens40

eDNA detections38

Sources7 archives

Databases and archives Acroneuria carolinensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 384 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 384 records

Environmental DNA1 datasets · 1 countries38 detections

DNA & barcodingBOLD40 specimens

01Narrative

Acroneuria carolinensis, the Carolina stone, is a species of common stonefly in the family Perlidae. It is found in North America. Carolina stone, Acroneuria carolinensis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroneuria carolinensis has left across the world's sequence archives.

At a glance

DNA specimens40

BINs3

Marker genes1

eDNA detections38

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

10Cmostly conserved

19Tmostly conserved

22Tmostly conserved

29Gmostly conserved

31Tmostly conserved

34Cmostly conserved

40Avariable

43Gmostly conserved

46Tmostly conserved

49Tmostly conserved

50Tvariable

52Gmostly conserved

55Tmostly conserved

61Tmostly conserved

67Tmostly conserved

74Cmostly conserved

76Cmostly conserved

79Cmostly conserved

88Cmostly conserved

121Cmostly conserved

124Cmostly conserved

130Gmostly conserved

163Amostly conserved

166Gmostly conserved

169Gmostly conserved

202Amostly conserved

206Cmostly conserved

208Tmostly conserved

235Cmostly conserved

247Cmostly conserved

262Amostly conserved

263Cmostly conserved

271Tmostly conserved

277Cmostly conserved

278Cvariable

280Gvariable

284Tmostly conserved

286Gvariable

287Tmostly conserved

289Amostly conserved

302Cvariable

313Cmostly conserved

319Gmostly conserved

325Tmostly conserved

334Cmostly conserved

337Cmostly conserved

352Gvariable

358Gvariable

376Cmostly conserved

391Tmostly conserved

403Amostly conserved

415Gvariable

436Tmostly conserved

448Cvariable

472Amostly conserved

478Avariable

490Cmostly conserved

508Gvariable

514Amostly conserved

517Gmostly conserved

523Cmostly conserved

529Avariable

533Tmostly conserved

535Avariable

541Amostly conserved

544Tmostly conserved

550Tmostly conserved

562Cmostly conserved

574Cmostly conserved

577Avariable

580Tmostly conserved

583Gmostly conserved

592Gmostly conserved

622Cmostly conserved

637Tmostly conserved

643Gvariable

653Cmostly conserved

655Avariable

658Tvariable

AACTTTATACTTCATCTTTGGTGCATGAGCTGGCATAGTAGGGACTTCTTTGAGTCTTCTTATTCGTGCTGAACTCGGCCAACCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.5%

Haplotypes11

BINs3

Most divergent pair20.4%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroneuria lycoriassame genus9.1%Acroneuria abnormissame genus14.9%Acroneuria arenosasame genus15.5%Acroneuria frisonisame genus16.1%Acroneuria internatasame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_053852 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 384 records

Wild obs. + sensor782

Museum / vouchered602

Range

Area of Occupancy AOO2 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 772≤1 km 4>10 km 1

777 georeferenced · 5 without coordinates

Open the mapobservation + sensor782

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 293≤1 km 98≤10 km 71

462 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence602

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	284
OEPAlocation not on record	168
WVDEPlocation not on record	48
Provo, US	18
USNMENTlocation not on record	18
Washington, US	10
BYUClocation not on record	9
Illinois Natural History Surveylocation not on record	7
C.P. Gillette Museum of Arthropod Diversitylocation not on record	7
West Virginia Universitylocation not on record	2
Western Kentucky Universitylocation not on record	2
Chicago, US	2
UKIClocation not on record	1
CUlocation not on record	1
PNHClocation not on record	1
Cleveland Museum of Natural Historylocation not on record	1
OSUClocation not on record	1
OHClocation not on record	1

18 institutions · 581 of 602 vouchered records shown · 21 without an institution code

09Environmental DNA38 detections

Where the DNA of Acroneuria carolinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map1 country0

riffle

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 7.40–16.4

Seasonal swing summer↔winter24.7 °C

Max temp (day)15.8 °C 12.5–21.5

Min temp (night)5.30 °C 1.90–11.8

Precipitation112 mm/mo 72.2–124

Air humidity57.0 % 55.5–59.5

Moisture balance9.70 mm/mo -21.1–26.4

Vapour deficit555 Pa 447–758

Wind speed3.10 m/s 2.00–4.50

Cloud cover46.5 % 39.2–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acroneuria carolinensis

At a glance

Sources7 archives

At a glance

Record type1 384 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 384 records