Acroneuria abnormis

(Newman, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Perlidae/Acroneuria

At a glance

Occurrence records3 760

Data sources8

Biological traits0

DNA specimens122

eDNA detections122

Sources8 archives

Databases and archives Acroneuria abnormis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 760 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI122 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 760 records

Environmental DNA1 datasets · 2 countries122 detections

DNA & barcodingBOLD122 specimens

01Narrative

Acroneuria abnormis, the common stone, is a species of common stonefly in the family Perlidae. It is found in North America. Common stone, Acroneuria abnormis During mating, pairs engage in drumming behavior that can be used to identify species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroneuria abnormis has left across the world's sequence archives.

At a glance

DNA specimens122

BINs4

Marker genes1

eDNA detections122

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus118 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 100 variable positions, in barcode order

28Amostly conserved

34Cmostly conserved

40Amostly conserved

46Tmostly conserved

47Gmostly conserved

49Cmostly conserved

58Tmostly conserved

61Cmostly conserved

79Tvariable

92Tmostly conserved

103Cmostly conserved

118Cmostly conserved

121Cvariable

136Cmostly conserved

148Amostly conserved

154Tvariable

172Tmostly conserved

175Gvariable

178Tmostly conserved

184Gmostly conserved

190Amostly conserved

199Amostly conserved

206Tmostly conserved

208Amostly conserved

214Tmostly conserved

217Gmostly conserved

220Avariable

229Amostly conserved

235Cmostly conserved

241Amostly conserved

247Cmostly conserved

250Cvariable

265Avariable

266Tmostly conserved

268Amostly conserved

274Amostly conserved

278Tmostly conserved

284Cmostly conserved

287Cmostly conserved

289Amostly conserved

292Gmostly conserved

298Tmostly conserved

307Cmostly conserved

319Gmostly conserved

328Amostly conserved

337Cmostly conserved

343Cmostly conserved

346Amostly conserved

349Tmostly conserved

355Amostly conserved

358Amostly conserved

364Tmostly conserved

367Tmostly conserved

373Tmostly conserved

376Cmostly conserved

379Cmostly conserved

385Cmostly conserved

391Tmostly conserved

403Gmostly conserved

424Gmostly conserved

430Amostly conserved

433Amostly conserved

436Cmostly conserved

439Amostly conserved

442Cmostly conserved

451Cmostly conserved

457Gmostly conserved

460Cmostly conserved

466Amostly conserved

481Amostly conserved

500Tvariable

505Tmostly conserved

520Tmostly conserved

523Cmostly conserved

529Gmostly conserved

530Tmostly conserved

532Gmostly conserved

535Gvariable

541Cmostly conserved

547Cmostly conserved

550Amostly conserved

562Cmostly conserved

565Gmostly conserved

577Amostly conserved

578Tmostly conserved

581Cvariable

595Tmostly conserved

598Amostly conserved

601Cmostly conserved

622Avariable

625Amostly conserved

628Cvariable

631Gmostly conserved

632Gmostly conserved

633Amostly conserved

641Tmostly conserved

643Amostly conserved

646Cmostly conserved

649Gmostly conserved

652Cmostly conserved

AACTTTATACTTCATCTTTGGTGCATGATCAGGCATAGTAGGTACTGCCCTAAGCCTTCTCATTCGTGCTGAACTTGGTCAACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes28

BINs4

Most divergent pair18.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroneuria carolinensissame genus14.9%Acroneuria lycoriassame genus15.5%Acroneuria frisonisame genus16.1%Eccoptura xanthenessame family17.0%Acroneuria internatasame genus17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 760 records

Wild obs. + sensor1 274

Museum / vouchered2 486

Range

Area of Occupancy AOO5 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 147≤1 km 39≤10 km 13>10 km 23

1 222 georeferenced · 52 without coordinates

Open the mapobservation + sensor1 274

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 882≤1 km 1 120≤10 km 277>10 km 18

2 297 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence2 486

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	1 641
UIHygenicslocation not on record	195
ISIClocation not on record	134
UWIRClocation not on record	79
WVDEPlocation not on record	63
UMSPlocation not on record	38
Tempe, US	32
University of Guelph, Centre for Biodiversity Genomicslocation not on record	29
Washington, US	25
Purdue Entomological Research Collectionlocation not on record	22
BYUClocation not on record	15
Chicago, US	14
Wuzhou, CN	13
OEPAlocation not on record	11
MSUARClocation not on record	10
Cornell University Insect Collectionlocation not on record	9
USNMENTlocation not on record	9
PNHClocation not on record	8
CNClocation not on record	8
CUlocation not on record	7
OSUClocation not on record	5
Provo, US	5
Ann Arbor, US	4
Western Kentucky Universitylocation not on record	4
INHS Insect Collectionlocation not on record	3
Cincinnati, US	3
Philadelphia, US	2
Saint John, CA	2
Helsinki, FI	1
University Park, US	1
Toronto, CA	1
Illinois Natural History Surveylocation not on record	1
The Atlantic reference Centrelocation not on record	1
RFKirchner-INHSlocation not on record	1
St. Paul, US	1
NDUClocation not on record	1
Royal Alberta Museumlocation not on record	1
SIUC-INHSlocation not on record	1

38 institutions · 2 400 of 2 486 vouchered records shown · 86 without an institution code

09Environmental DNA122 detections

Where the DNA of Acroneuria abnormis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found122

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 122 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestriffleRiverRiffle

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 8.50–20.0

Seasonal swing summer↔winter25.8 °C

Max temp (day)20.2 °C 13.6–25.2

Min temp (night)11.7 °C 3.10–15.7

Precipitation97.6 mm/mo 82.3–136

Air humidity58.2 % 55.6–59.6

Moisture balance-19.2 mm/mo -55.6–32.4

Vapour deficit719 Pa 475–986

Wind speed2.80 m/s 1.80–4.20

Cloud cover41.5 % 39.2–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acroneuria abnormis

At a glance

Sources8 archives

At a glance

Record type3 760 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 760 records