Acrolophus plumifrontella

Clemens, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records3 720

Data sources6

Biological traits0

DNA specimens108

eDNA detections110

Sources6 archives

Databases and archives Acrolophus plumifrontella's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 720 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics108 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 720 records

Environmental DNA1 datasets · 1 countries110 detections

DNA & barcodingBOLD108 specimens

01Narrative

Acrolophus plumifrontella, the eastern grass-tubeworm moth,Bug Guide is a moth of the family Acrolophidae. It is found in North America, including Alabama, Arizona, Arkansas, Florida, Georgia, Illinois, Indiana, Iowa, Kansas, Kentucky, Louisiana, Maryland, Mississippi, Missouri, New Jersey, New York, North Carolina, Ohio, Pennsylvania, South Carolina, Tennessee, Texas and Virginia.mothphotographersgroup The wingspan is about 28 mm. Adults are on wing from April to October.Insects of Iowa

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding108 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus plumifrontella has left across the world's sequence archives.

At a glance

DNA specimens108

BINs5

Marker genes1

eDNA detections110

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus108 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

40Gmostly conserved

49Tmostly conserved

76Gmostly conserved

118Tmostly conserved

121Amostly conserved

166Gmostly conserved

205Tmostly conserved

208Amostly conserved

220Tmostly conserved

268Cmostly conserved

290Gmostly conserved

316Amostly conserved

328Amostly conserved

337Cmostly conserved

361Tmostly conserved

367Tmostly conserved

370Amostly conserved

379Amostly conserved

412Amostly conserved

433Gmostly conserved

466Amostly conserved

470Amostly conserved

487Cvariable

523Tmostly conserved

529Tmostly conserved

565Amostly conserved

613Tmostly conserved

628Avariable

AACATTATACTTTATTTTTGGTATTTGATCTGGAATAGTGGGAACTTCTCTAAGCCTTTTAATTCGGGCTGAATTGGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes39

BINs5

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus cressonisame genus8.7%Acrolophus forbesisame genus8.8%Acrolophus comptussame genus9.3%Acrolophus arizonellussame genus9.3%Acrolophus filicornissame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 720 records

Wild obs. + sensor3 162

Museum / vouchered558

Range

Area of Occupancy AOO6 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 631≤1 km 443≤10 km 156>10 km 413

2 643 georeferenced · 519 without coordinates

Open the mapobservation + sensor3 162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 5≤1 km 110≤10 km 219>10 km 45

379 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence558

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	184
New Haven, US	130
Georgia Museum of Natural Historylocation not on record	82
East Lansing, US	68
CUlocation not on record	40
Washington, US	17
Philadelphia, US	11
ASUlocation not on record	9
Toronto, CA	4
Denver, US	4
King Saud Universitylocation not on record	4
University of Central Floridalocation not on record	2
St. Paul, US	1
San Francisco, US	1
OSUClocation not on record	1

15 institutions · 558 of 558 vouchered records shown

09Environmental DNA110 detections

Where the DNA of Acrolophus plumifrontella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map1 country0

calcareous prairie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 25.0–26.2

Seasonal swing summer↔winter14.3 °C

Max temp (day)31.4 °C 28.7–31.4

Min temp (night)22.2 °C 20.3–23.0

Precipitation182 mm/mo 117–183

Air humidity62.6 % 59.2–62.6

Moisture balance29.6 mm/mo -59.1–29.6

Vapour deficit1,263 Pa 1,260–1,353

Wind speed1.90 m/s 1.90–3.30

Cloud cover34.1 % 31.2–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 109 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus plumifrontella

At a glance

Sources6 archives

At a glance

Record type3 720 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 720 records