Acrolophus cressoni

Walsingham, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records1 314

Data sources7

Biological traits0

DNA specimens26

eDNA detections20

Sources7 archives

Databases and archives Acrolophus cressoni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 314 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 314 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD26 specimens

01Narrative

Acrolophus cressoni, Cresson's grass tubeworm, size: 8.8 mm Acrolophus cressoni (Cresson's grass tubeworm moth) is a moth of the family Acrolophidae.Retrieved April 23, 2018. It is found in North America, including Alabama, Arizona, Arkansas, Florida, Georgia, Kentucky, Louisiana, Mississippi, New Mexico, North Carolina, Oklahoma, Tennessee and Texas.mothphotographersgroup The wingspan is about 19 mm.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus cressoni has left across the world's sequence archives.

At a glance

DNA specimens26

BINs5

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

79Amostly conserved

88Avariable

91Tvariable

106Cvariable

127Cmostly conserved

133Tmostly conserved

154Cvariable

202Avariable

212Tmostly conserved

217Avariable

220Tvariable

226Tmostly conserved

265Amostly conserved

304Cmostly conserved

316Amostly conserved

340Tvariable

343Tvariable

352Tvariable

361Tmostly conserved

364Amostly conserved

368Gmostly conserved

370Tmostly conserved

385Tmostly conserved

403Cvariable

406Cvariable

412Amostly conserved

433Amostly conserved

470Amostly conserved

476Gmostly conserved

490Tmostly conserved

492Gmostly conserved

517Tvariable

547Tvariable

550Amostly conserved

574Tmostly conserved

577Avariable

578Tvariable

586Tmostly conserved

595Cvariable

601Cmostly conserved

613Tmostly conserved

616Cvariable

628Avariable

646Tmostly conserved

652Cvariable

653Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes16

BINs5

Most divergent pair7.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus maculifersame genus7.8%Acrolophus variabilissame genus7.9%Acrolophus comptussame genus8.2%Acrolophus hasbrouckisame genus8.5%Acrolophus plumifrontellasame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 314 records

Wild obs. + sensor1 214

Museum / vouchered100

Range

Area of Occupancy AOO1 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 687≤1 km 191≤10 km 17>10 km 104

999 georeferenced · 215 without coordinates

Open the mapobservation + sensor1 214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 2≤1 km 4≤10 km 15>10 km 3

24 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	75
Washington, US	12
Georgia Museum of Natural Historylocation not on record	6
St. Paul, US	4
East Lansing, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
ASUlocation not on record	1

7 institutions · 100 of 100 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Acrolophus cressoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 23.4–27.8

Seasonal swing summer↔winter19.9 °C

Max temp (day)31.4 °C 28.9–33.2

Min temp (night)21.5 °C 18.4–23.4

Precipitation94.6 mm/mo 63.1–182

Air humidity57.7 % 51.1–62.6

Moisture balance-72.6 mm/mo -147–29.6

Vapour deficit1,321 Pa 1,198–1,671

Wind speed3.90 m/s 1.90–4.50

Cloud cover31.3 % 23.7–34.2

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus cressoni

At a glance

Sources7 archives

At a glance

Record type1 314 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 314 records