Acrolophus piger

Dyar, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records2 003

Data sources7

Biological traits0

DNA specimens42

eDNA detections47

Sources7 archives

Databases and archives Acrolophus piger's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 003 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 003 records

Environmental DNA1 datasets · 2 countries47 detections

DNA & barcodingBOLD42 specimens

01Narrative

Acrolophus piger, the piger grass tubeworm moth, is a moth of the family Acrolophidae. It was described by Harrison Gray Dyar Jr. in 1900. It is found in North America, including Alabama, Florida, Mississippi, North Carolina, South Carolina and Texas.Moth Photographers Group at Mississippi State University The wingspan is about 16 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus piger has left across the world's sequence archives.

At a glance

DNA specimens42

BINs7

Marker genes1

eDNA detections47

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 108 variable positions, in barcode order

16Cmostly conserved

31Tmostly conserved

34Tmostly conserved

40Amostly conserved

49Cmostly conserved

50Cmostly conserved

52Tmostly conserved

67Gmostly conserved

70Amostly conserved

74Cmostly conserved

82Cmostly conserved

85Amostly conserved

88Tmostly conserved

91Amostly conserved

92Tmostly conserved

100Tmostly conserved

112Tvariable

118Cmostly conserved

124Cmostly conserved

127Tmostly conserved

130Amostly conserved

133Amostly conserved

139Amostly conserved

154Cmostly conserved

157Cmostly conserved

160Avariable

163Amostly conserved

166Avariable

169Amostly conserved

190Tmostly conserved

197Cmostly conserved

202Cmostly conserved

205Cmostly conserved

211Gmostly conserved

212Tmostly conserved

220Cmostly conserved

223Cmostly conserved

235Cmostly conserved

238Amostly conserved

265Avariable

266Cmostly conserved

268Cmostly conserved

274Avariable

277Amostly conserved

278Cmostly conserved

290Gmostly conserved

295Cmostly conserved

307Cmostly conserved

316Avariable

325Tmostly conserved

328Tmostly conserved

346Tmostly conserved

355Amostly conserved

364Tmostly conserved

367Cvariable

376Cmostly conserved

379Amostly conserved

382Amostly conserved

394Tmostly conserved

400Amostly conserved

401Tmostly conserved

403Gvariable

412Cmostly conserved

421Tvariable

424Cmostly conserved

436Amostly conserved

457Cmostly conserved

463Tmostly conserved

472Tmostly conserved

478Amostly conserved

481Avariable

484Amostly conserved

490Cmostly conserved

493Amostly conserved

499Cmostly conserved

500Cmostly conserved

508Tmostly conserved

514Amostly conserved

517Tmostly conserved

520Amostly conserved

530Tmostly conserved

532Amostly conserved

533Cmostly conserved

536Cmostly conserved

538Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Amostly conserved

550Amostly conserved

556Amostly conserved

557Tmostly conserved

559Amostly conserved

562Tmostly conserved

565Amostly conserved

574Amostly conserved

577Avariable

581Cmostly conserved

592Tmostly conserved

604Cmostly conserved

613Cmostly conserved

616Tmostly conserved

619Tmostly conserved

625Amostly conserved

634Cvariable

637Tmostly conserved

646Cmostly conserved

652Cmostly conserved

658Cvariable

AACATTATATTTTATCTTTGGTATTTGATCTGGTATAGTAGGAACTTCCCTTAGATTATTAATTCGGGCAGAACTAGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.3%

Haplotypes17

BINs6

Most divergent pair15.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus griseussame genus9.1%Acrolophus furcatussame genus10.8%Acrolophus kearfottisame genus10.8%Acrolophus heppnerisame genus11.1%Acrolophus sinclairisame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 003 records

Wild obs. + sensor1 957

Museum / vouchered46

Range

Area of Occupancy AOO2 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 006≤1 km 207≤10 km 16>10 km 187

1 416 georeferenced · 541 without coordinates

Open the mapobservation + sensor1 957

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 5≤10 km 8>10 km 1

15 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Mississippi State, US	11
Georgia Museum of Natural Historylocation not on record	6
St. Paul, US	4
New Haven, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

7 institutions · 46 of 46 vouchered records shown

09Environmental DNA47 detections

Where the DNA of Acrolophus piger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.5. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 25.2–26.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)29.6 °C 27.6–29.7

Min temp (night)24.1 °C 20.8–24.2

Precipitation48.7 mm/mo 21.2–274

Air humidity60.7 % 60.1–69.9

Moisture balance-133 mm/mo -168–105

Vapour deficit1,260 Pa 989–1,386

Wind speed4.20 m/s 2.90–5.40

Cloud cover16.3 % 15.9–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus piger

At a glance

Sources7 archives

At a glance

Record type2 003 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 003 records