Acrolophus heppneri

Davis, 1990 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records1 680

Data sources7

Biological traits0

DNA specimens22

eDNA detections240

Sources7 archives

Databases and archives Acrolophus heppneri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 680 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI240 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 680 records

Environmental DNA1 datasets · 7 countries240 detections

DNA & barcodingBOLD22 specimens

01Narrative

Acrolophus heppneri is a moth of the family Acrolophidae. It was described by Davis in 1990. It is found in North America, including the US states of Alabama, Florida, Mississippi and Texas.mothphotographersgroup The wingspan is about 17 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus heppneri has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections240

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

229Gvariable

361Tmostly conserved

466Gmostly conserved

478Tvariable

580Amostly conserved

AACATTATACTTCATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTCTTAGACTTTTAATTCGAGCAGAATTAGGAAACCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus panamaesame genus5.3%Acrolophus mycetophagussame genus9.4%Acrolophus sinclairisame genus9.4%Acrolophus cockerellisame genus9.6%Acrolophus persimplexsame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 680 records

Wild obs. + sensor1 585

Museum / vouchered95

Range

Area of Occupancy AOO2 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 909≤1 km 217≤10 km 35>10 km 145

1 306 georeferenced · 279 without coordinates

Open the mapobservation + sensor1 585

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 1≤1 km 1≤10 km 34

36 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	75
Washington, US	13
Cornell University Insect Collectionlocation not on record	2
St. Paul, US	2
San Francisco, US	1
Denver, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

7 institutions · 95 of 95 vouchered records shown

09Environmental DNA240 detections

Where the DNA of Acrolophus heppneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found240

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 240 detections have coordinates

Open the map7 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…Mixed habitatForest1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 21.0–27.2

Seasonal swing summer↔winter8.20 °C

Max temp (day)28.9 °C 24.4–30.2

Min temp (night)22.5 °C 17.9–23.2

Precipitation225 mm/mo 93.0–332

Air humidity65.2 % 62.6–76.7

Moisture balance58.5 mm/mo -10.6–218

Vapour deficit1,186 Pa 599–1,250

Wind speed2.00 m/s 1.70–2.50

Cloud cover28.8 % 20.9–33.3

CHELSA 1981–2010, ~9 km grid, at location & month of 238 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus heppneri

At a glance

Sources7 archives

At a glance

Record type1 680 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 680 records