Acrodipsas myrmecophila

(Waterhouse & Lyell, 1913) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Acrodipsas

At a glance

Occurrence records596

Data sources7

Biological traits0

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Acrodipsas myrmecophila's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility596 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF596 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acrodipsas myrmecophila, the small ant-blue, is a butterfly of the family Lycaenidae. It is found in the south-east of Australia. The wingspan is about 25 mm. The larvae feed on the larvae of the ant species Papyrius nitidus. The butterfly features on the logo of the Geelong Field Naturalists Club.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrodipsas myrmecophila has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P676 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTCTTTATTTTATTTTTGGTATTTGAGCTGGAATAATTGGTACTTCATTAAGTATTATAATTCGAATAGAATTAAGAACACCAAACTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrodipsas cupreasame genus5.0%Acrodipsas auratasame genus5.5%Acrodipsas brisbanensissame genus5.5%Actizera lucidasame family9.1%Anthene schoutedenisame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type596 records

Wild obs. + sensor202

Museum / vouchered393

Other1

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 4≤1 km 11≤10 km 184

199 georeferenced · 3 without coordinates

Open the mapobservation + sensor202

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 145≤1 km 2≤10 km 169>10 km 26

342 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence393

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	185
Sydney, AU	119
Cambridge, US	54
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	16
Natick, US	10
Western Australian Museumlocation not on record	6
Australian National Insect Collectionlocation not on record	1

7 institutions · 391 of 393 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Acrodipsas myrmecophila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 20.8–23.6

Seasonal swing summer↔winter16.5 °C

Max temp (day)28.5 °C 27.1–29.9

Min temp (night)15.0 °C 14.5–17.6

Precipitation15.6 mm/mo 2.70–35.9

Air humidity44.3 % 43.4–50.8

Moisture balance-141 mm/mo -143–-106

Vapour deficit1,605 Pa 1,297–1,624

Wind speed3.70 m/s 2.80–4.00

Cloud cover20.2 % 18.1–28.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)