Acrodipsas cuprea

(Sands, 1965) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Acrodipsas

At a glance

Occurrence records406

Data sources7

Biological traits0

DNA specimens24

eDNA detections22

Sources7 archives

Databases and archives Acrodipsas cuprea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF406 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD24 specimens

01Narrative

Acrodipsas cuprea, the copper ant-blue or cuprea ant-blue, is a butterfly of the family Lycaenidae. It is found in Australia, from southern Queensland to Victoria. The wingspan is about 20 mm. The larvae feed on the larvae of Crematogaster ant species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrodipsas cuprea has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections22

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P676 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

36Tmostly conserved

38Amostly conserved

40Tmostly conserved

49Amostly conserved

211Avariable

391Tmostly conserved

AACACTTTATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGTATCATAATTCGAATAGAATTAGGAACACCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes5

BIN1

Most divergent pair0.74%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrodipsas auratasame genus1.8%Acrodipsas brisbanensissame genus3.0%Acrodipsas myrmecophilasame genus5.0%Anthene paraffinissame family8.1%Enos tharasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type406 records

Wild obs. + sensor71

Museum / vouchered331

Other4

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 18≤1 km 34≤10 km 1>10 km 2

55 georeferenced · 16 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 8≤1 km 31≤10 km 128>10 km 10

177 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	125
Cambridge, US	83
Sydney, AU	64
Natick, US	34
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	11
Museum and Art Gallery of the Northern Territorylocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Western Australian Museumlocation not on record	4
Australian National Insect Collectionlocation not on record	2

9 institutions · 331 of 331 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Acrodipsas cuprea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)