Acroclita subsequana

(Herrich-Schäffer, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acroclita

At a glance

Occurrence records291

Data sources7

Biological traits2

DNA specimens239

eDNA detections254

Sources7 archives

Databases and archives Acroclita subsequana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility291 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI254 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics239 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF291 records

Environmental DNA1 datasets · 4 countries254 detections

DNA & barcodingBOLD239 specimens

01Narrative

Acroclita subsequana is een vlinder uit de familie bladrollers (Tortricidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1851 door Herrich-Schäffer. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding239 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroclita subsequana has left across the world's sequence archives.

At a glance

DNA specimens239

BINs7

Marker genes2

eDNA detections254

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus236 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

10Tmostly conserved

34Tvariable

38Gmostly conserved

40Avariable

50Tmostly conserved

67Amostly conserved

70Tmostly conserved

85Tvariable

97Tmostly conserved

100Amostly conserved

103Tvariable

106Tmostly conserved

115Tmostly conserved

133Avariable

163Amostly conserved

166Amostly conserved

169Tmostly conserved

181Amostly conserved

199Amostly conserved

205Avariable

214Avariable

223Amostly conserved

226Tmostly conserved

229Amostly conserved

232Avariable

250Tmostly conserved

265Amostly conserved

268Amostly conserved

274Cvariable

287Tmostly conserved

292Tmostly conserved

298Amostly conserved

316Amostly conserved

325Amostly conserved

349Tvariable

386Cmostly conserved

388Tvariable

391Tmostly conserved

400Tmostly conserved

415Amostly conserved

421Amostly conserved

424Amostly conserved

433Amostly conserved

436Amostly conserved

454Tmostly conserved

460Tvariable

472Tvariable

484Amostly conserved

517Avariable

520Amostly conserved

529Tmostly conserved

530Tmostly conserved

536Tmostly conserved

544Tmostly conserved

548Tmostly conserved

550Gvariable

568Tvariable

580Tmostly conserved

613Tmostly conserved

616Cmostly conserved

619Avariable

625Amostly conserved

628Amostly conserved

631Tmostly conserved

634Tvariable

637Tvariable

643Tmostly conserved

652Tmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 83 variants.

Diversity (π)3.5%

Haplotypes83

BINs7

Most divergent pair5.9%

AfricaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroclita sonchanasame genus3.0%Olethreutes devotanasame family6.8%Gypsonoma salicicolanasame family7.3%Phtheochroa canarianasame family7.6%Phtheochroa baracanasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type291 records

Wild obs. + sensor265

Museum / vouchered26

Origin

Native9

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 72≤1 km 87≤10 km 56>10 km 2

217 georeferenced · 48 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZAF-UMUlocation not on record	7
DABUHlocation not on record	5
Washington, US	4
Sevilla, ES	2

4 institutions · 18 of 26 vouchered records shown · 5 without an institution code

09Environmental DNA254 detections

Where the DNA of Acroclita subsequana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found254

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 254 detections have coordinates

Open the map4 countries0

coastal dunesdunes & oines

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 23.5–34.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)32.6 °C 30.5–43.2

Min temp (night)18.7 °C 17.0–24.2

Precipitation10.3 mm/mo 0.4–10.3

Air humidity43.0 % 38.2–52.6

Moisture balance-173 mm/mo -246–-170

Vapour deficit1,995 Pa 1,374–3,355

Wind speed2.10 m/s 2.10–4.30

Cloud cover28.2 % 9.60–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 219 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)