Acroclita sonchana

Walsingham, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acroclita

At a glance

Occurrence records15

Data sources8

Biological traits0

DNA specimens5

eDNA detections9

Sources8 archives

Databases and archives Acroclita sonchana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acroclita sonchana is a moth of the family Tortricidae. It is found on the Canary Islands.Fauna Europaea The wingspan is 14–17 mm. The forewings are dark fuscous, sprinkled and mottled with shades of chestnut brown. The hindwings are brownish cinereous (ashy grey). The larvae feed on the leaves of Sonchus gummifer and Sonchus leptocephalus. Young larvae are dull grey, but turn bright red before pupation.lepiforum.de

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroclita sonchana has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

271Amostly conserved

313Cmostly conserved

433Gvariable

553Avariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCACTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes4

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroclita subsequanasame genus3.0%Gypsonoma salicicolanasame family7.9%Olethreutes devotanasame family8.5%Gypsonoma nitidulanasame family8.5%Ancylis habelerisame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor12

Museum / vouchered3

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 7≤1 km 3>10 km 1

11 georeferenced · 1 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA9 detections

Where the DNA of Acroclita sonchana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Thermophile forestFayal-brezal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 12.9–18.6

Seasonal swing summer↔winter7.20 °C

Max temp (day)18.4 °C 14.5–19.7

Min temp (night)17.3 °C 11.7–17.7

Precipitation115 mm/mo 38.3–128

Air humidity60.1 % 52.3–67.0

Moisture balance31.3 mm/mo -86.0–37.8

Vapour deficit677 Pa 654–849

Wind speed3.70 m/s 3.50–4.70

Cloud cover38.3 % 34.2–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)