Acrocephalus bistrigiceps

Swinhoe, 1860 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Acrocephalidae/Acrocephalus

At a glance

Occurrence records28 320

Data sources8

Biological traits24

DNA specimens14

eDNA detections14

Sources8 archives

Databases and archives Acrocephalus bistrigiceps's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF28 320 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Der Brauenrohrsänger (Acrocephalus bistrigiceps) ist ein Singvogel aus der Gattung der Rohrsänger (Acrocephalus) und der Familie der Rohrsängerartigen (Acrocephalidae).Brauenrohrsänger, in Avibase – Die Weltvogel-Datenbank. Abgerufen am . Verbreitungsgebiet des Brauenrohrsängers. Brutgebiet gelb, Überwinterungsgebiet blau Der Vogel kommt vom Osten der Mongolei und dem Südosten Russlands bis zum Osten Chinas, in Japan und selten auf der Koreanischen Halbinsel vor. Er überwintert von Nordostindien und Süd- und Südostchina bis zur Malaiischen Halbinsel. Der Lebensraum umfasst verschiedenen wassernahen Bewuchs wie Riedgräser mit Weidenbüscheln und anderen Sträuchern, hohes Gras, Schilf, auch Reisfelder, Weiden entlang von Flüssen, feuchte Waldränder bis 1500 m Höhe.A. Dyrcz: Black-browed Reed Warbler (Acrocephalus bistrigiceps), version 1.0. In: J. del Hoyo, A. Elliott, J. Sargatal, D. A. Christie und E. de Juana (Herausgeber): Birds of the World. 2020, Cornell Lab of Ornithology, Ithaca, NY, USA. Black-browed Reed Warbler Das Artepitheton setzt sich zusammen aus der Vorsilbe , und .J. A. Jobling: A Dictionary of Scientific Bird Names. Oxford University Press. 1991. ISBN 0-19-854634-3. Früher wurde die Art als konspezifisch mit dem Mandschurenrohrsänger (Acrocephalus tangorum) angesehen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth2.6 mm

Beak length (culmen)13.4 mm

Beak length (nares)7.7 mm

Beak width3 mm

Body mass8.5 g

Body mass (female)8.25 g

Body mass (male)9.45 g

Hand-wing index21.9

Kipp's distance11.4 mm

Secondary length40.7 mm

Tail length50.4 mm

Tarsus length20.1 mm

Wing length52.7 mm

Life cycle & reproduction2

Egg mass1.33 g

Litter size4.9

Diet & foraging5

Ground50 %

Invertebrate100 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory50 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleInsessorial

Range size4 170 337 km²

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrocephalus bistrigiceps has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

79Gmostly conserved

133Cmostly conserved

409Gmostly conserved

640Cmostly conserved

CCTATACCTAATCTTCGGCACATGAGCCGGAATAGTAGGTACCGCCCTCAGCCTCCTTATTCGAGCAGAACTAGGCCAGCCAGGTGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrocephalus melanopogonsame genus8.2%Acrocephalus schoenobaenussame genus8.5%Acrocephalus baeticatussame genus10.0%Iduna natalensissame family10.1%Acrocephalus agricolasame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~5.31 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5.31 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type28 320 records

Wild obs. + sensor28 066

Museum / vouchered254

Origin

Native2

Range

Area of Occupancy AOO16 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 363≤1 km 652≤10 km 143>10 km 61

1 219 georeferenced · 26 847 without coordinates

Open the mapobservation + sensor28 066

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 10≤10 km 121>10 km 21

152 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence254

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	65
MNHAHlocation not on record	44
Seattle, US	44
SNSDlocation not on record	28
New Haven, US	21
Berkeley, US	21
Helsinki, FI	9
Philadelphia, US	4
NHMOlocation not on record	3
Wuzhou, CN	2
Geneva, CH	2
NSMKlocation not on record	2
Ann Arbor, US	2
Vancouver, CA	1
RBINS-Scientific Heritagelocation not on record	1
Brussels, BE	1

16 institutions · 250 of 254 vouchered records shown · 4 without an institution code

09Environmental DNA14 detections

Where the DNA of Acrocephalus bistrigiceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 13.9–23.1

Seasonal swing summer↔winter24.4 °C

Max temp (day)21.7 °C 16.0–24.4

Min temp (night)12.6 °C 11.1–21.6

Precipitation124 mm/mo 57.9–211

Air humidity64.1 % 59.7–67.4

Moisture balance17.1 mm/mo -77.3–96.4

Vapour deficit748 Pa 516–1,010

Wind speed3.20 m/s 2.70–4.00

Cloud cover44.1 % 42.9–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrocephalus bistrigiceps

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging5

Habitat & environment4

At a glance

At a glance

When this lineage existed

Record type28 320 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type28 320 records