Acrobasis advenella

(Zincken, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records32 573

Data sources7

Biological traits0

DNA specimens101

eDNA detections107

Sources7 archives

Databases and archives Acrobasis advenella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 573 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics101 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 573 records

Environmental DNA3 datasets · 12 countries107 detections

DNA & barcodingBOLD101 specimens

01Narrative

Acrobasis advenella is a species of snout moth in the genus Acrobasis. It was described by Johann Zincken in 1818 and is found in most of Europe. The wingspan is 17–24 mm. The moth flies in one generation from July to August .. Fig. 4 larva after final moult The larvae feed on Crataegus, Pyrus and Sorbus aucuparia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding101 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis advenella has left across the world's sequence archives.

At a glance

DNA specimens101

BINs1

Marker genes1

eDNA detections107

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus97 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

88Amostly conserved

106Cmostly conserved

166Gmostly conserved

190Gmostly conserved

217Avariable

274Cvariable

310Amostly conserved

343Tmostly conserved

382Cmostly conserved

548Tmostly conserved

553Amostly conserved

628Gmostly conserved

631Amostly conserved

634Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes40

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis obtusellasame genus7.4%Edulica compedellasame family7.8%Acrobasis blanchardorumsame genus7.9%Macrorrhinia pintasame family7.9%Acrobasis suavellasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type32 573 records

Wild obs. + sensor30 307

Museum / vouchered2 260

Other6

Origin

Native37

Range

Area of Occupancy AOO24 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 10 548≤1 km 3 550≤10 km 14 225>10 km 57

28 380 georeferenced · 1 927 without coordinates

Open the mapobservation + sensor30 307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 1 092≤1 km 352≤10 km 441>10 km 297

2 182 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence2 260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	932
Helsinki, FI	752
NHMOlocation not on record	124
SLU Artdatabankenlocation not on record	68
Tartu, EE	41
Kuopio, FI	31
Natural History Museum Rotterdamlocation not on record	29
DABUHlocation not on record	27
NTNU-VMlocation not on record	16
ZMAAlocation not on record	13
Philadelphia, US	12
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	11
Salzburg, AT	11
Zürich, CH	9
ZSMlocation not on record	5
Nijmegen, NL	5
neflocation not on record	4
Rovaniemi, FI	4
South Kensington, GB	4
CBDClocation not on record	4
MZLUlocation not on record	3
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	3
Provincia di Livornolocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Metsähallituslocation not on record	1
University of Kaiserslauternlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Brussels, BE	1
BioFokuslocation not on record	1
NMBU:MINAlocation not on record	1

31 institutions · 2 119 of 2 260 vouchered records shown · 141 without an institution code

09Environmental DNA107 detections

Where the DNA of Acrobasis advenella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys3

Countries12

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map12 countries0

dry grasslandedge forestprivate gardenFloodplain forestfutaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 13.2–20.5

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.0 °C 17.0–25.2

Min temp (night)13.8 °C 8.40–15.8

Precipitation77.5 mm/mo 48.4–118

Air humidity58.6 % 56.3–62.8

Moisture balance-40.4 mm/mo -79.4–3.30

Vapour deficit846 Pa 607–1,053

Wind speed3.00 m/s 2.10–4.20

Cloud cover36.0 % 33.2–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 103 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrobasis advenella

At a glance

Sources7 archives

At a glance

Record type32 573 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type32 573 records