Acraea satis

Ward, 1871 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records360

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Acraea satis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF360 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acraea satis, the east coast acraea, is a butterfly of the family Nymphalidae. It is found in Zimbabwe, KwaZulu-Natal, Mozambique, Tanzania and Kenya.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea satis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 2 variable positions, in barcode order

238Cvariable

484Tvariable

AACATTATATTTTATTTTTGGGATCTGATCTGGAATAGTAGGGACATCTTTAAGTATACTAATTCGAATAGAACTAGGAAATCCTGGATG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Curvie emesiasame order9.6%Acerra normalissame order10.5%Libytheana motyasame family10.8%Blenina lichenosasame order11.4%Macrauzata submontanasame order11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type360 records

Wild obs. + sensor21

Museum / vouchered339

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 6

8 georeferenced · 13 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 17>10 km 1

19 georeferenced · 320 without coordinates

Open the institutions mapphysical evidence339

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	194
Teylers Museumlocation not on record	50
Durban Natural Science Museumlocation not on record	36
National Museums of Kenyalocation not on record	20
New Haven, US	18
DNSMlocation not on record	9
KwaZulu-Natal Museumlocation not on record	5
Cape Town, ZA	3
Sydney, AU	2
Cambridge, US	1
Northern Michigan Universitylocation not on record	1

11 institutions · 339 of 339 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Acraea satis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)