Acerra normalis

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acerra

At a glance

Occurrence records538

Data sources7

Biological traits0

DNA specimens20

eDNA detections18

Sources7 archives

Databases and archives Acerra normalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF538 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD20 specimens

01Narrative

Acerra is a monotypic genus of moths of the family Noctuidae. Its sole species, Acerra normalis, is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acerra normalis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

99Gmostly conserved

238Tmostly conserved

592Avariable

604Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACCTCATTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stretchia primasame family3.6%Stretchia plusiaeformissame family3.8%Stretchia pictipennissame family4.0%Harutaeographa cinereasame family4.1%Perigrapha cilissasame family4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type538 records

Wild obs. + sensor267

Museum / vouchered271

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 137≤1 km 35≤10 km 5>10 km 13

190 georeferenced · 77 without coordinates

Open the mapobservation + sensor267

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 36≤1 km 2≤10 km 17>10 km 3

58 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	104
Vernal, US	51
Colorado State Universitylocation not on record	34
University of Alberta Museums (UAM)location not on record	32
New Haven, US	17
Helsinki, FI	10
San Francisco, US	3
ASUlocation not on record	3
St. Paul, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
US	1
WWUlocation not on record	1

12 institutions · 261 of 271 vouchered records shown · 10 without an institution code

09Environmental DNA18 detections

Where the DNA of Acerra normalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 3.90–12.6

Seasonal swing summer↔winter14.6 °C

Max temp (day)16.4 °C 6.80–18.0

Min temp (night)5.50 °C -0.1–7.50

Precipitation78.0 mm/mo 28.1–164

Air humidity56.3 % 52.0–62.4

Moisture balance-15.1 mm/mo -60.4–89.3

Vapour deficit538 Pa 336–645

Wind speed2.20 m/s 1.60–2.90

Cloud cover44.0 % 40.2–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)