Acraea quirina

Fabricius, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Acraea

At a glance

Occurrence records455

Data sources7

Biological traits0

DNA specimens16

eDNA detections15

Sources7 archives

Databases and archives Acraea quirina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 5 countries15 detections

DNA & barcodingBOLD16 specimens

01Narrative

Acraea quirina, the common glassy acraea, is a butterfly in the family Nymphalidae. It is found in Senegal, Gambia, Guinea, Sierra Leone, Burkina Faso, Liberia, Ivory Coast, Ghana, Togo, Nigeria, Cameroon, Gabon, the Republic of the Congo, the Central African Republic, Angola, the Democratic Republic of the Congo, Sudan, Uganda, Ethiopia, Kenya, Tanzania and Malawi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraea quirina has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections15

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

25Amostly conserved

43Gmostly conserved

82Cmostly conserved

133Tmostly conserved

184Tmostly conserved

187Tmostly conserved

202Cmostly conserved

235Cmostly conserved

268Tmostly conserved

277Amostly conserved

280Amostly conserved

281Amostly conserved

287Tmostly conserved

364Tmostly conserved

373Amostly conserved

379Cmostly conserved

412Tmostly conserved

415Gmostly conserved

428Cmostly conserved

474Amostly conserved

494Amostly conserved

508Cmostly conserved

517Amostly conserved

523Cmostly conserved

539Cmostly conserved

541Gmostly conserved

553Gmostly conserved

562Cmostly conserved

574Cmostly conserved

616Tmostly conserved

619Amostly conserved

622Tmostly conserved

634Tmostly conserved

646Tmostly conserved

AACTTTATATTTCATTTTTGGTGTATGATCAGGAATAATTGGGACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes3

BINs2

Most divergent pair0.30%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraea hamatasame genus7.9%Acraea leucographasame genus8.4%Acraea eltringhamisame genus8.5%Polites sabuletisame order9.6%Lascoria anxasame order9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type455 records

Wild obs. + sensor16

Museum / vouchered425

Other14

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 8≤1 km 6≤10 km 1

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 19>10 km 10

29 georeferenced · 396 without coordinates

Open the institutions mapphysical evidence425

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	377
New Haven, US	15
National Museums of Kenyalocation not on record	14
Cambridge, US	11
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Natural History Museum Rotterdamlocation not on record	3
Durban Natural Science Museumlocation not on record	1

7 institutions · 425 of 425 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Acraea quirina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.2–27.2

Seasonal swing summer↔winter2.60 °C

Max temp (day)28.0 °C 25.7–29.6

Min temp (night)21.6 °C 19.4–26.2

Precipitation223 mm/mo 75.4–305

Air humidity69.0 % 63.2–71.3

Moisture balance166 mm/mo

Vapour deficit947 Pa 867–1,298

Wind speed2.00 m/s

Cloud cover49.6 % 28.9–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)